PI-PspI
NEBU cloned at NEB recombinant dil_B 65 No ralbumin

We are excited to announce that all reaction buffers are now BSA-free. NEB began switching our BSA-containing reaction buffers in April 2021 to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence TGGCAAACAGCTA_TTAT^GGGTATTATGGGT
  • This is a homing endonuclease
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
Special Offer for Q4 Ladders
Catalog # Concentration Size List Price Your Price Quantity
R0695S 5,000 units/ml 500 units $80.00
Please enter a quantity for at least one size
Loading Spinner