PI-PspI
cloned at NEB recombinant NEBU dil_B 65 No BSA

We are excited to announce that we are in the process of switching all reaction buffers to be BSA-free. Beginning April 2021, we will be gradually transitioning to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. All information on the website has been updated to reflect this change. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence TGGCAAACAGCTA_TTAT^GGGTATTATGGGT

Having supplied restriction enzymes to the research community for over 45 years, NEB has earned the reputation of being the leader in enzyme technologies.  Working continuously to be worthy of that distinction, NEB strives to develop enzyme of the highest purity and unparalleled quality.

  • This is a homing endonuclease
  • Tolerates some sequence degeneracy within recognition sequence
  • Cut Site: TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
Catalog # Concentration Size List Price Your Price Quantity
R0695S 5,000 units/ml 500 units $72.00
Please enter a quantity for at least one size
Loading Spinner