PI-PspI
cloned at NEB recombinant NEBU dil_B 65 No BSA

R0695_PI-PspI_cutsite

Having supplied restriction enzymes to the research community for over 45 years, NEB has earned the reputation of being the leader in enzyme technologies.  Working continuously to be worthy of that distinction, NEB strives to develop enzyme of the highest purity and unparalleled quality.

  • This is a homing endonuclease
  • Tolerates some sequence degeneracy within recognition sequence
  • Cut Site: TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
Catalog # Concentration Size List Price Your Price Quantity
R0695S 5,000 units/ml 500 units $72.00
Please enter a quantity for at least one size
Loading Spinner