Please ensure Javascript is enabled for purposes of website accessibility I-CeuI | NEB

I-CeuI
Gray property icon for rCutSmart recombinant Gray property icon for dilB Gray property icon for incubation temperature 37° Gray property icon for heat inactivation 65°

I-CeuI has been reformulated with Recombinant Albumin (rAlbumin) beginning with Lot #10344151. Learn more.

NEB restriction endonuclease that recognizes the sequence CGTAACTATAACGGTC_CTAA^GGTAGCGAA
  • 100% activity in rCutSmart™ Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests
  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
Catalog # Cat # Concentration Conc Size List Price List Price Your Price Quantity
R0699S 5,000 units/ml 500 units $88.00 $88.00
R0699L 5,000 units/ml 2,500 units $366.00 $366.00
Please enter a quantity for at least one size

Need a custom/large volume order? Contact us

)
Loading Spinner