I-CeuI
neb31 recombinant dil_B 37 65 Heat

We are excited to announce that all reaction buffers are now BSA-free. NEB began switching our BSA-containing reaction buffers in April 2021 to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence CGTAACTATAACGGTC_CTAA^GGTAGCGAA
  • 100% activity in rCutSmart Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests
  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
Catalog # Concentration Size List Price Your Price Quantity
R0699S 5,000 units/ml 500 units $85.00
R0699L 5,000 units/ml 2,500 units $354.00
Please enter a quantity for at least one size

Need a custom/large volume order? Contact us
Loading Spinner