Please ensure Javascript is enabled for purposes of website accessibility Why Choose Recombinant Enzymes? | NEB

Why Choose Recombinant Enzymes?

Established in 1975 as a private cooperative of experienced scientists, New England Biolabs is a world leader in the production of restriction endonucleases and related products for recombinant DNA technology. NEB has consistently maintained a position at the forefront of this field, and has successfully linked enzyme production efficiency to basic research in the cloning and overexpression of restriction/modification enzyme systems. This enables NEB to introduce substantial cuts in reagent costs and unsurpassed improvements in product quality and purity. Presently, NEB supplies more than 275 restriction enzymes, over 250 of which are available in recombinant form, as well as numerous recombinant polymerases and modifying enzymes for a wide variety of applications.

Why choose a recombinant enzyme?

Purity

Once an enzyme system is cloned, choice of expression vector and strain background allows tight control over the production environment. For restriction endonucleases, this eliminates enzymes known to contaminate native preparations. For example, when producing AvrII (NEB #R0174) from the native strain Anabaena variabilis, great care must be taken to eliminate AvrI. Similarly, when producing HaeIII (NEB #R0108) from Haemophilus aegyptius, the enzyme must be purified free of HaeII (NEB #R0107). Choice of background strain also plays a key role in eliminating nonspecific endonucleases and exonucleases. Although recombinant enzymes and native enzymes are manufactured to meet the same rigorous quality control standards, it is recombinant enzymes that produce a more pure product with less processing time.

Consistency

Typically, the yields obtained for recombinant and overexpressed enzymes are significantly larger than those produced by native strains. Production of larger lots means greater product consistency and less lot-to-lot variation. Further, this large lot capability is ideal for customers that have a need for bulk quantities of enzymes. It simplifies their quality assurance procedures by reducing the time and effort normally spent to qualify enzymes supplied from different lots.

Affordability

At NEB, the introduction of recombinant enzymes has resulted in lower $/unit charges. Recombinant enzymes with lower $/unit cost allows our customers to experience substantial savings, while benefiting from improved purity and consistency of product.

Advances

Cloning does more than increase product quality and purity. There are many examples where native strains do not produce sufficient levels of desirable enzymes. For example, cloning of enzyme systems such as AvrII (NEB #R0174), BcgI (NEB #R0545), BspHI (NEB #R0517), HgaI (NEB #R0154), KasI (NEB #R0544), and NgoMIV (NEB #R0564) has led to these being commercially available. Also, recombinant enzymes are easier to manipulate at the genetic level often leading to the commercialization of new enzymes with useful biochemical properties. For example, the thermal stable enzyme Vent® DNA Polymerase has a 3´ - 5´ exonuclease. Cloning of the Vent® DNA Polymerase gene led to the production of an exo¯ version of the enzyme that is now widely preferred for DNA sequencing.

We are excited to announce that all reaction buffers are now BSA-free. NEB began switching our BSA-containing reaction buffers in April 2021 to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes.Find more details at www.neb.com/BSA-free.

 Recombinant Enzymes From NEB:

Enzyme Supplied NEBuffer Sequence Properties
AatII rCutSmart™ Buffer GACGT/C  
Acc65I NEBuffer™ r3.1 G/GTACC   
AccI rCutSmart™ Buffer GT/MKAC  
AciI rCutSmart™ Buffer CCGC(-3/-1)  
AclI rCutSmart™ Buffer AA/CGTT  
AcuI rCutSmart™ Buffer CTGAAG(16/14)  
AfeI rCutSmart™ Buffer AGC/GCT
AflII rCutSmart™ Buffer C/TTAAG  
AflIII NEBuffer™ r3.1 A/CRYGT
AgeI-HF® rCutSmart™ Buffer A/CCGGT  
AhdI rCutSmart™ Buffer GACNNN/NNGTC  
AleI-v2 rCutSmart™ Buffer CACNN/NNGTG
AluI rCutSmart™ Buffer AG/CT  
AlwI rCutSmart™ Buffer GGATC(4/5)  
AlwNI rCutSmart™ Buffer CAGNNN/CTG   
ApaI rCutSmart™ Buffer GGGCC/C   
ApaLI rCutSmart™ Buffer G/TGCAC  
ApeKI @75°C NEBuffer™ r3.1 G/CWGC  
ApoI-HF rCutSmart™ Buffer R/AATTY  
AscI rCutSmart™ Buffer GG/CGCGCC  
AseI NEBuffer™ r3.1 AT/TAAT  
AsiSI rCutSmart™ Buffer GCGAT/CGC
AvaI rCutSmart™ Buffer C/YCGRG  
AvaII rCutSmart™ Buffer G/GWCC   
AvrII rCutSmart™ Buffer C/CTAGG  
Enzyme Back to top Supplied NEBuffer Sequence Properties
BaeGI NEBuffer™ r3.1 GKGCM/C  
BaeI rCutSmart™ Buffer (10/15)ACNNNNGTAYC(12/7)  
BamHI § NEBuffer™ r3.1 G/GATCC  
BamHI-HF® rCutSmart™ Buffer G/GATCC  
BanI rCutSmart™ Buffer G/GYRCC  
BanII rCutSmart™ Buffer GRGCY/C
BbsI § NEBuffer™ r2.1 GAAGAC(2/6)  
BbsI-HF® rCutSmart™ Buffer GAAGAC(2/6)  
BbvCI rCutSmart™ Buffer CCTCAGC(-5/-2)
BbvI rCutSmart™ Buffer GCAGC(8/12)  
BccI rCutSmart™ Buffer CCATC(4/5)
BceAI NEBuffer™ r3.1 ACGGC(12/14)
BcgI NEBuffer™ r3.1 (10/12)CGANNNNNNTGC(12/10)  
BciVI rCutSmart™ Buffer GTATCC(6/5)  
BclI § NEBuffer™ r3.1 T/GATCA   
BclI-HF rCutSmart™ Buffer T/GATCA   
BcoDI rCutSmart™ Buffer GTCTC(1/5)  
BfaI rCutSmart™ Buffer C/TAG
BfuAI @50°C NEBuffer™ r3.1 ACCTGC(4/8)  
BglI NEBuffer™ r3.1 GCCNNNN/NGGC  
BglII NEBuffer™ r3.1 A/GATCT  
BlpI rCutSmart™ Buffer GC/TNAGC  
BmgBI NEBuffer™ r3.1 CACGTC(-3/-3)  
BmrI NEBuffer™ r2.1 ACTGGG(5/4)
BmtI-HF® rCutSmart™ Buffer GCTAG/C  
BpmI NEBuffer™ r3.1 CTGGAG(16/14)
BpuEI rCutSmart™ Buffer CTTGAG(16/14)  
Bpu10I NEBuffer™ r3.1 CCTNAGC(-5/-2)
BsaAI rCutSmart™ Buffer YAC/GTR  
BsaBI @60°C rCutSmart™ Buffer GATNN/NNATC  
BsaHI rCutSmart™ Buffer GR/CGYC   
BsaI-HF®v2 rCutSmart™ Buffer GGTCTC(1/5)   
BsaJI @60°C rCutSmart™ Buffer C/CNNGG
BsaWI @60°C rCutSmart™ Buffer W/CCGGW  
BsaXI rCutSmart™ Buffer (9/12)ACNNNNNCTCC(10/7)  
BseRI rCutSmart™ Buffer GAGGAG(10/8)  
BseYI NEBuffer™ r3.1 CCCAGC(-5/-1)
BsgI rCutSmart™ Buffer GTGCAG(16/14)  
BsiEI @60°C rCutSmart™ Buffer CGRY/CG  
BsiHKAI @65°C rCutSmart™ Buffer GWGCW/C  
BsiWI § @55°C NEBuffer™ r3.1 C/GTACG  
BsiWI-HF® rCutSmart™ Buffer C/GTACG  
BslI rCutSmart™ Buffer CCNNNNN/NNGG   
BsmAI rCutSmart™ Buffer GTCTC(1/5)  
BsmBI-v2 @55°C NEBuffer™ r3.1 CGTCTC  
BsmFI rCutSmart™ Buffer GGGAC(10/14)  
BsmI @65°C rCutSmart™ Buffer GAATGC(1/-1)  
BsoBI rCutSmart™ Buffer C/YCGRG  
BspCNI rCutSmart™ Buffer CTCAG(9/7)  
BspDI rCutSmart™ Buffer AT/CGAT  
BspEI NEBuffer™ r3.1 T/CCGGA   
BspHI rCutSmart™ Buffer T/CATGA   
Bsp1286I rCutSmart™ Buffer GDGCH/C  
BspMI NEBuffer™ r3.1 ACCTGC(4/8)
BspQI @50°C NEBuffer™ r3.1 GCTCTTC(1/4)  
BspQI-HF® § rCutSmart™ Buffer GCTCTTC(1/4)  
BsrBI rCutSmart™ Buffer CCGCTC(-3/-3)  
BsrDI NEBuffer™ r2.1 GCAATG(2/0)  
BsrFI-v2 rCutSmart™ Buffer R/CCGGY  
BsrGI-HF® rCutSmart™ Buffer T/GTACA  
BsrI @65°C NEBuffer™ r3.1 ACTGG(1/-1)  
BssHII rCutSmart™ Buffer G/CGCGC  
BssSI-v2 rCutSmart™ Buffer CACGAG(-5/-1)  
BstAPI @60°C rCutSmart™ Buffer GCANNNN/NTGC
BstBI @65°C rCutSmart™ Buffer TT/CGAA  
BstEII-HF® rCutSmart™ Buffer G/GTNACC  
BstNI @60°C NEBuffer™ r3.1 CC/WGG  
BstUI @60°C rCutSmart™ Buffer CG/CG  
BstXI NEBuffer™ r3.1 CCANNNNN/NTGG   
BstYI @60°C rCutSmart™ Buffer R/GATCY  
BstZ17I-HF® rCutSmart™ Buffer GTATAC  
Bsu36I rCutSmart™ Buffer CC/TNAGG  
BtgI rCutSmart™ Buffer C/CRYGG  
BtgZI @60°C rCutSmart™ Buffer GCGATG(10/14)
BtsCI @50°C rCutSmart™ Buffer GGATG(2/0)  
BtsIMutI @55°C rCutSmart™ Buffer CAGTG(2/0)
BtsI-v2 rCutSmart™ Buffer GCAGTG(2/0)  
Enzyme Back to top Supplied NEBuffer Sequence Properties
Cac8I rCutSmart™ Buffer GCN/NGC  
ClaI rCutSmart™ Buffer AT/CGAT   
CspCI rCutSmart™ Buffer (11/13)CAANNNNNGTGG(12/10)  
CviKI-1 rCutSmart™ Buffer RG/CY
CviQI @25°C NEBuffer™ r3.1 G/TAC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
DdeI rCutSmart™ Buffer C/TNAG  
DpnI rCutSmart™ Buffer GA/TC  
DpnII NEBuffer™ DpnII /GATC   
DraI rCutSmart™ Buffer TTT/AAA  
DraIII-HF® rCutSmart™ Buffer CACNNN/GTG  
DrdI rCutSmart™ Buffer GACNNNN/NNGTC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
EaeI rCutSmart™ Buffer Y/GGCCR  
EagI-HF® rCutSmart™ Buffer C/GGCCG  
EarI rCutSmart™ Buffer CTCTTC(1/4)  
EciI rCutSmart™ Buffer GGCGGA(11/9)
Eco53kI rCutSmart™ Buffer GAG/CTC  
EcoNI rCutSmart™ Buffer CCTNN/NNNAGG  
EcoO109I rCutSmart™ Buffer RG/GNCCY   
EcoP15I NEBuffer™ r3.1 CAGCAG(25/27)  
EcoRI § NEBuffer™ EcoRI/SspI G/AATTC  
EcoRI-HF® rCutSmart™ Buffer G/AATTC  
EcoRV § NEBuffer™ r3.1 GAT/ATC  
EcoRV-HF® rCutSmart™ Buffer GAT/ATC  
Esp3I rCutSmart™ Buffer CGTCTC(1/5)  
Enzyme Back to top Supplied NEBuffer Sequence Properties
FatI @55°C NEBuffer™ r2.1 /CATG
FauI @55°C rCutSmart™ Buffer CCCGC(4/6)
Fnu4HI rCutSmart™ Buffer GC/NGC  
FokI rCutSmart™ Buffer GGATG(9/13)  
FseI rCutSmart™ Buffer GGCCGG/CC   
FspI rCutSmart™ Buffer TGC/GCA  
Enzyme Back to top Supplied NEBuffer Sequence Properties
HaeII rCutSmart™ Buffer RGCGC/Y  
HaeIII rCutSmart™ Buffer GG/CC  
HgaI NEBuffer™ r1.1 GACGC(5/10)
HhaI rCutSmart™ Buffer GCG/C  
HincII rCutSmart™ Buffer GTY/RAC  
HindIII § NEBuffer™ r2.1 A/AGCTT
HindIII-HF® rCutSmart™ Buffer A/AGCTT  
HinfI rCutSmart™ Buffer G/ANTC  
HinP1I rCutSmart™ Buffer G/CGC  
HpaI rCutSmart™ Buffer GTT/AAC
HpaII rCutSmart™ Buffer C/CGG  
HphI rCutSmart™ Buffer GGTGA(8/7)   
HpyAV rCutSmart™ Buffer CCTTC(6/5)  
HpyCH4III rCutSmart™ Buffer ACN/GT
HpyCH4IV rCutSmart™ Buffer A/CGT  
HpyCH4V rCutSmart™ Buffer TG/CA  
Hpy188I rCutSmart™ Buffer TCN/GA  
Hpy99I rCutSmart™ Buffer CGWCG/
Hpy166II rCutSmart™ Buffer GTN/NAC  
Hpy188III rCutSmart™ Buffer TC/NNGA  
Enzyme Back to top Supplied NEBuffer Sequence Properties
I-CeuI rCutSmart™ Buffer TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceI rCutSmart™ Buffer TAGGGATAACAGGGTAAT(-9/-13)
Enzyme Back to top Supplied NEBuffer Sequence Properties
KasI rCutSmart™ Buffer G/GCGCC
KpnI-HF® rCutSmart™ Buffer GGTAC/C  
Enzyme Back to top Supplied NEBuffer Sequence Properties
MboI rCutSmart™ Buffer /GATC   
MboII rCutSmart™ Buffer GAAGA(8/7)   
MfeI-HF® rCutSmart™ Buffer C/AATTG  
MluCI rCutSmart™ Buffer /AATT  
MluI-HF® rCutSmart™ Buffer A/CGCGT  
MlyI rCutSmart™ Buffer GAGTC(5/5)  
MmeI rCutSmart™ Buffer TCCRAC(20/18)  
MnlI rCutSmart™ Buffer CCTC(7/6)  
MscI rCutSmart™ Buffer TGG/CCA  
MseI rCutSmart™ Buffer T/TAA  
MslI rCutSmart™ Buffer CAYNN/NNRTG  
MspA1I rCutSmart™ Buffer CMG/CKG  
MspI rCutSmart™ Buffer C/CGG  
MspJI rCutSmart™ Buffer CNNR(9/13)
MwoI @60°C rCutSmart™ Buffer GCNNNNN/NNGC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
NaeI rCutSmart™ Buffer GCC/GGC
NarI rCutSmart™ Buffer GG/CGCC
Nb.BbvCI rCutSmart™ Buffer CCTCAGC(none/-2)
Nb.BsmI @65°C NEBuffer™ r3.1 GAATGC(none/-1)
Nb.BsrDI rCutSmart™ Buffer GCAATG(none/0)
Nb.BssSI NEBuffer™ r3.1 CACGAG(none/-1)
Nb.BtsI rCutSmart™ Buffer GCAGTG(none/0)
NciI rCutSmart™ Buffer CC/SGG  
NcoI § NEBuffer™ r3.1 C/CATGG  
NcoI-HF® rCutSmart™ Buffer C/CATGG  
NdeI rCutSmart™ Buffer CA/TATG  
NgoMIV rCutSmart™ Buffer G/CCGGC  
NheI-HF® rCutSmart™ Buffer G/CTAGC  
NlaIII rCutSmart™ Buffer CATG/  
NlaIV rCutSmart™ Buffer GGN/NCC  
NmeAIII rCutSmart™ Buffer GCCGAG(21/19)
NotI § NEBuffer™ r3.1 GC/GGCCGC  
NotI-HF® rCutSmart™ Buffer GC/GGCCGC  
NruI-HF® rCutSmart™ Buffer TCG/CGA   
NsiI § NEBuffer™ r3.1 ATGCA/T  
NsiI-HF® rCutSmart™ Buffer ATGCA/T  
NspI rCutSmart™ Buffer RCATG/Y  
Nt.AlwI rCutSmart™ Buffer GGATC(4/none)  
Nt.BbvCI rCutSmart™ Buffer CCTCAGC(-5/none)
Nt.BsmAI rCutSmart™ Buffer GTCTC(1/none)
Nt.BspQI @50°C NEBuffer™ r3.1 GCTCTTC(1/none)
Nt.BstNBI @55°C NEBuffer™ r3.1 GAGTC(4/none)
Nt.CviPII rCutSmart™ Buffer CCD(-3/none)
Enzyme Back to top Supplied NEBuffer Sequence Properties
PacI rCutSmart™ Buffer TTAAT/TAA  
PaeR7I rCutSmart™ Buffer C/TCGAG  
PaqCI rCutSmart™ Buffer CACCTGC(4/8)
PciI NEBuffer™ r3.1 A/CATGT
PflFI rCutSmart™ Buffer GACN/NNGTC  
PflMI NEBuffer™ r3.1 CCANNNN/NTGG   
PI-PspI @65°C NEBuffer™ PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-SceI NEBuffer™ PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
PleI rCutSmart™ Buffer GAGTC(4/5)
PluTI rCutSmart™ Buffer GGCGC/C
PmeI rCutSmart™ Buffer GTTT/AAAC  
PmlI rCutSmart™ Buffer CAC/GTG  
PpuMI rCutSmart™ Buffer RG/GWCCY   
PshAI rCutSmart™ Buffer GACNN/NNGTC  
PsiI-v2 rCutSmart™ Buffer TTA/TAA  
PspGI @75°C rCutSmart™ Buffer /CCWGG  
PspOMI rCutSmart™ Buffer G/GGCCC  
PspXI rCutSmart™ Buffer VC/TCGAGB
PstI § NEBuffer™ r3.1 CTGCA/G  
PstI-HF® rCutSmart™ Buffer CTGCA/G  
PvuI-HF® rCutSmart™ Buffer CGAT/CG  
PvuII § NEBuffer™ r3.1 CAG/CTG  
PvuII-HF® rCutSmart™ Buffer CAG/CTG  
Enzyme Back to top Supplied NEBuffer Sequence Properties
RsaI rCutSmart™ Buffer GT/AC  
RsrII rCutSmart™ Buffer CG/GWCCG
Enzyme Back to top Supplied NEBuffer Sequence Properties
SacI-HF® rCutSmart™ Buffer GAGCT/C  
SacII rCutSmart™ Buffer CCGC/GG  
SalI § NEBuffer™ r3.1 G/TCGAC  
SalI-HF® rCutSmart™ Buffer G/TCGAC  
SapI rCutSmart™ Buffer GCTCTTC(1/4)  
Sau3AI NEBuffer™ r1.1 /GATC
Sau96I rCutSmart™ Buffer G/GNCC  
SbfI-HF® rCutSmart™ Buffer CCTGCA/GG  
ScaI-HF® rCutSmart™ Buffer AGT/ACT  
ScrFI rCutSmart™ Buffer CC/NGG  
SexAI rCutSmart™ Buffer A/CCWGGT  
SfaNI NEBuffer™ r3.1 GCATC(5/9)
SfcI rCutSmart™ Buffer C/TRYAG
SfiI @50°C rCutSmart™ Buffer GGCCNNNN/NGGCC   
SfoI rCutSmart™ Buffer GGC/GCC   
SgrAI rCutSmart™ Buffer CR/CCGGYG
SmaI rCutSmart™ Buffer CCC/GGG  
SmlI @55°C rCutSmart™ Buffer C/TYRAG
SnaBI rCutSmart™ Buffer TAC/GTA
SpeI-HF® rCutSmart™ Buffer A/CTAGT  
SphI § NEBuffer™ r2.1 GCATG/C
SphI-HF® rCutSmart™ Buffer GCATG/C  
SrfI rCutSmart™ Buffer GCCC/GGGC  
SspI-HF® rCutSmart™ Buffer AAT/ATT  
StuI rCutSmart™ Buffer AGG/CCT   
StyD4I rCutSmart™ Buffer /CCNGG   
StyI-HF® rCutSmart™ Buffer C/CWWGG  
SwaI @25°C NEBuffer™ r3.1 ATTT/AAAT  
Enzyme Back to top Supplied NEBuffer Sequence Properties
TaqI-v2 @65°C rCutSmart™ Buffer T/CGA   
TfiI @65°C rCutSmart™ Buffer G/AWTC  
TseI @65°C rCutSmart™ Buffer G/CWGC  
Tsp45I @65°C rCutSmart™ Buffer /GTSAC
TspMI @75°C rCutSmart™ Buffer C/CCGGG  
TspRI @65°C rCutSmart™ Buffer NNCASTGNN/  
Tth111I @65°C rCutSmart™ Buffer GACN/NNGTC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
WarmStart® Nt.BstNBI @55°C NEBuffer™ r3.1 GAGTC(4/none)
Enzyme Back to top Supplied NEBuffer Sequence Properties
XbaI rCutSmart™ Buffer T/CTAGA   
XcmI NEBuffer™ r2.1 CCANNNNN/NNNNTGG
XhoI rCutSmart™ Buffer C/TCGAG  
XmaI rCutSmart™ Buffer C/CCGGG  
XmnI rCutSmart™ Buffer GAANN/NNTTC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
ZraI rCutSmart™ Buffer GAC/GTC
)
Loading Spinner