Enzymes with Nonpalindromic Sequences

All recognition sequences are written 5' to 3' using the single letter code nomenclature. Numbers in parentheses indicate the point of cleavage.

Example, GGTCTC(1/5) indicates cleavage at:
5'...GGTCTCN/...3'
3'...CCAGAGNNNN/...5'

Enzyme Recognition Sequence
AciI CCGC(-3/-1)
AcuI CTGAAG(16/14)
AlwI GGATC(4/5)
BaeI (10/15)ACNNNNGTAYC(12/7)
BbsI § GAAGAC(2/6)
BbsI-HF® GAAGAC(2/6)
BbvCI CCTCAGC(-5/-2)
BbvI GCAGC(8/12)
BccI CCATC(4/5)
BceAI ACGGC(12/14)
BcgI (10/12)CGANNNNNNTGC(12/10)
BciVI GTATCC(6/5)
BcoDI GTCTC(1/5)
BfuAI ACCTGC(4/8)
BmgBI CACGTC(-3/-3)
BmrI ACTGGG(5/4)
BpmI CTGGAG(16/14)
BpuEI CTTGAG(16/14)
Bpu10I CCTNAGC(-5/-2)
BsaI § GGTCTC(1/5)
BsaI-HF® GGTCTC(1/5)
BsaXI (9/12)ACNNNNNCTCC(10/7)
BseRI GAGGAG(10/8)
BseYI CCCAGC(-5/-1)
BsgI GTGCAG(16/14)
BsmAI GTCTC(1/5)
BsmBI CGTCTC(1/5)
BsmFI GGGAC(10/14)
BsmI GAATGC(1/-1)
BspCNI CTCAG(9/7)
BspMI ACCTGC(4/8)
BspQI GCTCTTC(1/4)
BsrBI CCGCTC(-3/-3)
BsrDI GCAATG(2/0)
BsrI ACTGG(1/-1)
BssSαI CACGAG(-5/-1)
BtgZI GCGATG(10/14)
BtsαI GCAGTG(2/0)
BtsCI GGATG(2/0)
BtsIMutI CAGTG(2/0)
CspCI (11/13)CAANNNNNGTGG(12/10)
EarI CTCTTC(1/4)
EciI GGCGGA(11/9)
EcoP15I CAGCAG(25/27)
FauI CCCGC(4/6)
FokI GGATG(9/13)
FspEI CC(12/16)
HgaI GACGC(5/10)
HphI GGTGA(8/7)
HpyAV CCTTC(6/5)
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceI TAGGGATAACAGGGTAAT(-9/-13)
LpnPI CCDG(10/14)
MboII GAAGA(8/7)
MlyI GAGTC(5/5)
MmeI TCCRAC(20/18)
MnlI CCTC(7/6)
MspJI CNNR(9/13)
Nb.BbvCI CCTCAGC
Nb.BsmI GAATGC
Nb.BsrDI GCAATG
Nb.BssSI CACGAG
Nb.BtsI GCAGTG
NmeAIII GCCGAG(21/19)
Nt.AlwI GGATC(4/-5)
Nt.BbvCI CCTCAGC(-5/-7)
Nt.BsmAI GTCTC(1/-5)
Nt.BspQI GCTCTTC(1/-7)
Nt.BstNBI GAGTC(4/-5)
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
PleI GAGTC(4/5)
SapI GCTCTTC(1/4)
SfaNI GCATC(5/9)
§ A HF version of this enzyme is available.