Alphabetized List of Recognition Specificities

All restriction endonuclease recognition specificities available from New England Biolabs are listed below. For enzymes that recognize non-palindromic sequences, the complementary sequence of each strand is listed. For example, CCTC(7/6) and (6/7)GAGG both represent an MnlI (NEB #R0163) site.

All recognition sequences are written 5´ to 3´ using the single letter code nomenclature with the point of cleavage indicated by a "/".

Numbers in parentheses indicate point of cleaveage for non-palindromic enzymes.

For example, GGTCTC(1/5) indicates cleavage at:
5´ ...GGTCTCN/...3´
3´ ...CCAGAGNNNNN/...5´

Recognition Sequence Enzyme
GACGT/C AatII
CNNNNNNNNNNN/NNNNNNNNNG AbaSI
GT/MKAC AccI
G/GTACC Acc65I
CCGC(-3/-1) AciI
AA/CGTT AclI
CTGAAG(16/14) AcuI
AGC/GCT AfeI
C/TTAAG AflII
A/CRYGT AflIII
A/CCGGT AgeI AgeI-HF®
GACNNN/NNGTC AhdI
CACNN/NNGTG AleI-v2
AG/CT AluI
GGATC(4/5) AlwI
CAGNNN/CTG AlwNI
GGGCC/C ApaI
G/TGCAC ApaLI
R/AATTY ApoI ApoI-HF
GG/CGCGCC AscI
AT/TAAT AseI
GCGAT/CGC AsiSI
C/YCGRG AvaI BsoBI
G/GWCC AvaII
C/CTAGG AvrII
GKGCM/C BaeGI
(10/15)ACNNNNGTAYC(12/7) BaeI
G/GATCC BamHI BamHI-HF®
G/GYRCC BanI
GRGCY/C BanII
GAAGAC(2/6) BbsI BbsI-HF®
CCTCAGC(-5/-2) BbvCI
GCAGC(8/12) BbvI
CCATC(4/5) BccI
ACGGC(12/14) BceAI
(10/12)CGANNNNNNTGC(12/10) BcgI
GTATCC(6/5) BciVI
T/GATCA BclI BclI-HF
C/TAG BfaI
GCCNNNN/NGGC BglI
A/GATCT BglII
GC/TNAGC BlpI
CACGTC(-3/-3) BmgBI
ACTGGG(5/4) BmrI
GCTAG/C BmtI BmtI-HF®
CTGGAG(16/14) BpmI
CTTGAG(16/14) BpuEI
CCTNAGC(-5/-2) Bpu10I
YAC/GTR BsaAI
GATNN/NNATC BsaBI
GR/CGYC BsaHI
GGTCTC(1/5) BsaI BsaI-HF®v2
C/CNNGG BsaJI
W/CCGGW BsaWI
(9/12)ACNNNNNCTCC(10/7) BsaXI
GAGGAG(10/8) BseRI
CCCAGC(-5/-1) BseYI
GTGCAG(16/14) BsgI
CGRY/CG BsiEI
GWGCW/C BsiHKAI
C/GTACG BsiWI BsiWI-HF®
CCNNNNN/NNGG BslI
GTCTC(1/5) BsmAI BcoDI
CGTCTC BsmBI-v2
GGGAC(10/14) BsmFI
GAATGC(1/-1) BsmI
CTCAG(9/7) BspCNI
T/CCGGA BspEI
T/CATGA BspHI
GDGCH/C Bsp1286I
ACCTGC(4/8) BspMI BfuAI
CCGCTC(-3/-3) BsrBI
GCAATG(2/0) BsrDI
R/CCGGY BsrFI-v2
T/GTACA BsrGI BsrGI-HF®
ACTGG(1/-1) BsrI
G/CGCGC BssHII
CACGAG(-5/-1) BssSI-v2
GCANNNN/NTGC BstAPI
TT/CGAA BstBI
G/GTNACC BstEII  BstEII-HF®
CC/WGG BstNI
CG/CG BstUI
CCANNNNN/NTGG BstXI
R/GATCY BstYI
GTATAC BstZ17I-HF®
CC/TNAGG Bsu36I
C/CRYGG BtgI
GCGATG(10/14) BtgZI
GGATG(2/0) BtsCI
CAGTG(2/0) BtsIMutI
GCAGTG(2/0) BtsI-v2
GCN/NGC Cac8I
AT/CGAT ClaI BspDI
(11/13)CAANNNNNGTGG(12/10) CspCI
C/ATG CviAII
RG/CY CviKI-1
G/TAC CviQI
C/TNAG DdeI
GA/TC DpnI
TTT/AAA DraI
CACNNN/GTG DraIII-HF®
GACNNNN/NNGTC DrdI
Y/GGCCR EaeI
C/GGCCG EagI EagI-HF®
CTCTTC(1/4) EarI
GGCGGA(11/9) EciI
GAG/CTC Eco53kI
CCTNN/NNNAGG EcoNI
RG/GNCCY EcoO109I
CAGCAG(25/27) EcoP15I
G/AATTC EcoRI EcoRI-HF®
GAT/ATC EcoRV EcoRV-HF®
CGTCTC(1/5) Esp3I
/CATG FatI
CCCGC(4/6) FauI
GC/NGC Fnu4HI
GGATG(9/13) FokI
GGCCGG/CC FseI
CC(12/16) FspEI
TGC/GCA FspI
RGCGC/Y HaeII
GG/CC HaeIII
GACGC(5/10) HgaI
GCG/C HhaI
GTY/RAC HincII
A/AGCTT HindIII HindIII-HF®
G/ANTC HinfI
G/CGC HinP1I
GTT/AAC HpaI
GGTGA(8/7) HphI
CCTTC(6/5) HpyAV
ACN/GT HpyCH4III
A/CGT HpyCH4IV
TG/CA HpyCH4V
CGWCG/ Hpy99I
TCN/GA Hpy188I
GTN/NAC Hpy166II
TC/NNGA Hpy188III
TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) I-CeuI
TAGGGATAACAGGGTAAT(-9/-13) I-SceI
G/GCGCC KasI
GGTAC/C KpnI KpnI-HF®
CCDG(10/14) LpnPI
/GATC MboI Sau3AI DpnII
GAAGA(8/7) MboII
C/AATTG MfeI MfeI-HF®
/AATT MluCI
A/CGCGT MluI MluI-HF®
GAGTC(5/5) MlyI
TCCRAC(20/18) MmeI
CCTC(7/6) MnlI
TGG/CCA MscI
T/TAA MseI
CAYNN/NNRTG MslI
CMG/CKG MspA1I
C/CGG MspI HpaII
CNNR(9/13) MspJI
GCNNNNN/NNGC MwoI
GCC/GGC NaeI
GG/CGCC NarI
CCTCAGC Nb.BbvCI
GAATGC Nb.BsmI
GCAATG Nb.BsrDI
CACGAG Nb.BssSI
GCAGTG Nb.BtsI
CC/SGG NciI
C/CATGG NcoI NcoI-HF®
CA/TATG NdeI
G/CCGGC NgoMIV
G/CTAGC NheI NheI-HF®
CATG/ NlaIII
GGN/NCC NlaIV
GCCGAG(21/19) NmeAIII
GC/GGCCGC NotI NotI-HF®
TCG/CGA NruI NruI-HF®
ATGCA/T NsiI NsiI-HF®
RCATG/Y NspI
GGATC(4/-5) Nt.AlwI
CCTCAGC(-5/-7) Nt.BbvCI
GTCTC(1/-5) Nt.BsmAI
GCTCTTC(1/-7) Nt.BspQI
GAGTC(4/-5) Nt.BstNBI
(0/-1)CCD Nt.CviPII
TTAAT/TAA PacI
A/CATGT PciI
CCANNNN/NTGG PflMI
TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) PI-PspI
ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) PI-SceI
GAGTC(4/5) PleI
GGCGC/C PluTI
GTTT/AAAC PmeI
CAC/GTG PmlI
RG/GWCCY PpuMI
GACNN/NNGTC PshAI
TTA/TAA PsiI-v2
/CCWGG PspGI
G/GGCCC PspOMI
VC/TCGAGB PspXI
CTGCA/G PstI PstI-HF®
CGAT/CG PvuI PvuI-HF®
CAG/CTG PvuII PvuII-HF®
GT/AC RsaI
CG/GWCCG RsrII
GAGCT/C SacI SacI-HF®
CCGC/GG SacII
G/TCGAC SalI SalI-HF®
GCTCTTC(1/4) SapI BspQI
G/GNCC Sau96I
CCTGCA/GG SbfI SbfI-HF®
AGT/ACT ScaI-HF®
CC/NGG ScrFI
A/CCWGGT SexAI
GCATC(5/9) SfaNI
C/TRYAG SfcI
GGCCNNNN/NGGCC SfiI
GGC/GCC SfoI
CR/CCGGYG SgrAI
CCC/GGG SmaI
C/TYRAG SmlI
TAC/GTA SnaBI
A/CTAGT SpeI SpeI-HF®
GCATG/C SphI SphI-HF®
GCCC/GGGC SrfI
AAT/ATT SspI SspI-HF®
AGG/CCT StuI
/CCNGG StyD4I
C/CWWGG StyI-HF®
ATTT/AAAT SwaI
T/CGA TaqI-v2
G/AWTC TfiI
G/CWGC TseI ApeKI
/GTSAC Tsp45I
NNCASTGNN/ TspRI
GACN/NNGTC Tth111I PflFI
T/CTAGA XbaI
CCANNNNN/NNNNTGG XcmI
C/TCGAG XhoI PaeR7I
C/CCGGG XmaI TspMI
GAANN/NNTTC XmnI
GAC/GTC ZraI
Loading Spinner