Alphabetized List of Recognition Specificities

All restriction endonuclease recognition specificities available from New England Biolabs are listed below. For enzymes that recognize non-palindromic sequences, the complementary sequence of each strand is listed. For example, CCTC(7/6) and (6/7)GAGG both represent an MnlI (NEB #R0163) site.

All recognition sequences are written 5´ to 3´ using the single letter code nomenclature with the point of cleavage indicated by a "/".

Numbers in parentheses indicate point of cleaveage for non-palindromic enzymes.

For example, GGTCTC(1/5) indicates cleavage at:
5´ ...GGTCTCN/...3´
3´ ...CCAGAGNNNNN/...5´

Recognition Sequence Enzyme
AA/CGTT AclI
A/AGCTT HindIII HindIII-HF®
AAT/ATT SspI SspI-HF®
/AATT MluCI
A/CATGT PciI
A/CCGGT AgeI AgeI-HF®
ACCTGC(4/8) BspMI BfuAI
A/CCWGGT SexAI
A/CGCGT MluI MluI-HF®
ACGGC(12/14) BceAI
A/CGT HpyCH4IV
ACN/GT HpyCH4III
(10/15)ACNNNNGTAYC(12/7) BaeI
(9/12)ACNNNNNCTCC(10/7) BsaXI
A/CRYGT AflIII
A/CTAGT SpeI SpeI-HF®
ACTGG(1/-1) BsrI
ACTGGG(5/4) BmrI
A/GATCT BglII
AGC/GCT AfeI
AG/CT AluI
AGG/CCT StuI
AGT/ACT ScaI-HF®
AT/CGAT BspDI ClaI
ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) PI-SceI
ATGCA/T NsiI NsiI-HF®
AT/TAAT AseI
ATTT/AAAT SwaI
(11/13)CAANNNNNGTGG(12/10) CspCI
C/AATTG MfeI MfeI-HF®
CACGAG(-5/-1) BssSαI
CACGAG Nb.BssSI
CACGTC(-3/-3) BmgBI
CAC/GTG PmlI
CACNNN/GTG DraIII-HF®
CACNN/NNGTG AleI
CAGCAG(25/27) EcoP15I
CAG/CTG PvuII PvuII-HF®
CAGNNN/CTG AlwNI
CAGTG(2/0) BtsIMutI
CA/TATG NdeI
CATG/ NlaIII
C/ATG CviAII
/CATG FatI
CAYNN/NNRTG MslI
CC(12/16) FspEI
CCANNNNN/NNNNTGG XcmI
CCANNNNN/NTGG BstXI
CCANNNN/NTGG PflMI
CCATC(4/5) BccI
C/CATGG NcoI NcoI-HF®
CCCAGC(-5/-1) BseYI
CCCGC(4/6) FauI
C/CCGGG TspMI XmaI
CCC/GGG SmaI
CCDG(10/14) LpnPI
CCGC(-3/-1) AciI
CCGC/GG SacII
CCGCTC(-3/-3) BsrBI
C/CGG HpaII MspI
CC/NGG ScrFI
/CCNGG StyD4I
C/CNNGG BsaJI
CCNNNNN/NNGG BslI
C/CRYGG BtgI
CC/SGG NciI
C/CTAGG AvrII
CCTC(7/6) MnlI
CCTCAGC(-5/-2) BbvCI
CCTCAGC(-5/-7) Nt.BbvCI
CCTCAGC Nb.BbvCI
CCTGCA/GG SbfI SbfI-HF®
CCTNAGC(-5/-2) Bpu10I
CC/TNAGG Bsu36I
CCTNN/NNNAGG EcoNI
CCTTC(6/5) HpyAV
/CCWGG PspGI
CC/WGG BstNI
C/CWWGG StyI StyI-HF®
(10/12)CGANNNNNNTGC(12/10) BcgI
CGAT/CG PvuI PvuI-HF®
CG/CG BstUI
C/GGCCG EagI EagI-HF®
CG/GWCCG RsrII
CGRY/CG BsiEI
C/GTACG BsiWI BsiWI-HF®
CGTCTC(1/5) BsmBI
CGWCG/ Hpy99I
CMG/CKG MspA1I
CNNR(9/13) MspJI
CR/CCGGYG SgrAI
C/TAG BfaI
CTCAG(9/7) BspCNI
C/TCGAG XhoI PaeR7I
CTCTTC(1/4) EarI
CTGAAG(16/14) AcuI
CTGCA/G PstI PstI-HF®
CTGGAG(16/14) BpmI
C/TNAG DdeI
C/TRYAG SfcI
C/TTAAG AflII
CTTGAG(16/14) BpuEI
C/TYRAG SmlI
C/YCGRG AvaI BsoBI
GAAGA(8/7) MboII
GAAGAC(2/6) BbsI BbsI-HF®
GAANN/NNTTC XmnI
GAATGC Nb.BsmI
GAATGC(1/-1) BsmI
G/AATTC EcoRI EcoRI-HF®
GACGC(5/10) HgaI
GACGT/C AatII
GAC/GTC ZraI
GACN/NNGTC Tth111I PflFI
GACNN/NNGTC PshAI
GACNNN/NNGTC AhdI
GACNNNN/NNGTC DrdI
GAGCT/C SacI SacI-HF®
GAG/CTC Eco53kI
GAGGAG(10/8) BseRI
GAGTC(4/-5) Nt.BstNBI
GAGTC(5/5) MlyI
GAGTC(4/5) PleI
G/ANTC HinfI
GAT/ATC EcoRV EcoRV-HF®
GA/TC DpnI
/GATC BfuCI Sau3AI MboI DpnII
GATNN/NNATC BsaBI
G/AWTC TfiI
GCAATG Nb.BsrDI
GCAATG(2/0) BsrDI
GCAGC(8/12) BbvI
GCAGTG(2/0) BtsαI
GCAGTG Nb.BtsI
GCANNNN/NTGC BstAPI
GCATC(5/9) SfaNI
GCATG/C SphI SphI-HF®
GCCC/GGGC SrfI
GCCGAG(21/19) NmeAIII
GCC/GGC NaeI
G/CCGGC NgoMIV
GCCNNNN/NGGC BglI
GCGAT/CGC AsiSI
GCGATG(10/14) BtgZI
G/CGC HinP1I
GCG/C HhaI
G/CGCGC BssHII
GC/GGCCGC NotI NotI-HF®
GC/NGC Fnu4HI
GCN/NGC Cac8I
GCNNNNN/NNGC MwoI
G/CTAGC NheI NheI-HF®
GCTAG/C BmtI BmtI-HF®
GCTCTTC(1/-7) Nt.BspQI
GCTCTTC(1/4) BspQI SapI
GC/TNAGC BlpI
G/CWGC TseI ApeKI
GDGCH/C Bsp1286I
GGATC(4/5) AlwI
GGATC(4/-5) Nt.AlwI
G/GATCC BamHI BamHI-HF®
GGATG(9/13) FokI
GGATG(2/0) BtsCI
GG/CC HaeIII
GGCCGG/CC FseI
GGCCNNNN/NGGCC SfiI
GGCGC/C PluTI
G/GCGCC KasI
GG/CGCC NarI
GGC/GCC SfoI
GG/CGCGCC AscI
GGCGGA(11/9) EciI
GGGAC(10/14) BsmFI
G/GGCCC PspOMI
GGGCC/C ApaI
G/GNCC Sau96I
GGN/NCC NlaIV
G/GTACC Acc65I
GGTAC/C KpnI KpnI-HF®
GGTCTC(1/5) BsaI BsaI-HF®
GGTGA(8/7) HphI
G/GTNACC BstEII  BstEII-HF®
G/GWCC AvaII
G/GYRCC BanI
GKGCM/C BaeGI
GR/CGYC BsaHI
GRGCY/C BanII
G/TAC CviQI
GT/AC RsaI
GTATAC BstZ17I-HF®
GTATCC(6/5) BciVI
G/TCGAC SalI SalI-HF®
GTCTC(1/-5) Nt.BsmAI
GTCTC(1/5) BcoDI BsmAI
G/TGCAC ApaLI
GTGCAG(16/14) BsgI
GT/MKAC AccI
GTN/NAC Hpy166II
/GTSAC Tsp45I
GTT/AAC HpaI
GTTT/AAAC PmeI
GTY/RAC HincII
GWGCW/C BsiHKAI
NNCASTGNN/ TspRI
R/AATTY ApoI ApoI-HF
RCATG/Y NspI
R/CCGGY BsrFαI
R/GATCY BstYI
RGCGC/Y HaeII
RG/CY CviKI-1
RG/GNCCY EcoO109I
RG/GWCCY PpuMI
TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) I-CeuI
TAC/GTA SnaBI
TAGGGATAACAGGGTAAT(-9/-13) I-SceI
T/CATGA BspHI
T/CCGGA BspEI
TCCRAC(20/18) MmeI
T/CGA TaqαI
TCG/CGA NruI NruI-HF®
TCN/GA Hpy188I
TC/NNGA Hpy188III
T/CTAGA XbaI
T/GATCA BclI BclI-HF
TG/CA HpyCH4V
TGC/GCA FspI
TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) PI-PspI
TGG/CCA MscI
T/GTACA BsrGI BsrGI-HF®
T/TAA MseI
TTAAT/TAA PacI
TTA/TAA PsiI
TT/CGAA BstBI
TTT/AAA DraI
VC/TCGAGB PspXI
W/CCGGW BsaWI
YAC/GTR BsaAI
Y/GGCCR EaeI
Loading Spinner