Please ensure Javascript is enabled for purposes of website accessibility Dam-Dcm and CpG Methylation | NEB

Dam-Dcm and CpG Methylation

DNA methyltransferases (MTases) that transfer a methyl group from S-adenosylmethionine to either adenine or cytosine residues, are found in a wide variety of prokaryotes and eukaryotes. Methylation should be considered when digesting DNA with restriction endonucleases because cleavage can be blocked or impaired when a particular base in the recognition site is methylated.

Prokaryotic Methylation

In prokaryotes, MTases have most often been identified as elements of restriction/modification systems that act to protect host DNA from cleavage by the corresponding restriction endonuclease. Most laboratory strains of E. coli contain three site-specific DNA methylases.

  • Dam methylase–methylation at the N6 position of the adenine in the sequence GATC (1,2).
  • Dcm methyltransferases–methylation at the C5 position of the second cytosine in the sequences CCAGG and CCTGG (1,3).
  • EcoKI methylase–methylation of adenine in the sequences AAC(N6)GTGC and GCAC(N6)GTT.

Some or all of the sites for a restriction endonuclease may be resistant to cleavage when isolated from strains expressing the Dam or Dcm methylases if the methylase recognition site overlaps the endonuclease recognition site. For example, plasmid DNA isolated from dam+ E. coli is completely resistant to cleavage by MboI, which cleaves at GATC sites.

Not all DNA isolated from E. coli is methylated to the same extent. While pBR322 DNA is fully modified (and is therefore completely resistant to MboI digestion), only about 50% of λ DNA Dam sites are methylated, presumably because the methylase does not have the opportunity to methylate the DNA fully before it is packaged into the phage head. As a result, enzymes blocked by Dam or Dcm modification will yield partial digestion patterns with λ DNA.

Restriction sites that are blocked by Dam or Dcm methylation can be un-methylated by cloning your DNA into a dam–, dcm– strain of E. coli, such as dam–/dcm– Competent E. coli (NEB #C2925).

Restriction sites can also be blocked if an overlapping site is present. In this case, part of the Dam or Dcm sequence is generated by the restriction enzyme sequence, followed by the flanking sequence. This situation should also be considered when designing restriction enzyme digests.

Eukaryotic Methylation

CpG MTases, found in higher eukaryotes (e.g., Dnmt1), transfer a methyl group to the C5 position of cytosine residues. Patterns of CpG methylation are heritable, tissue specific and correlate with gene expression. Consequently, CpG methylation has been postulated to play a role in differentiation and gene expression (4).

Note: The effects of CpG methylation are mainly a concern when digesting eukaryotic genomic DNA. CpG methylation patterns are not retained once the DNA is cloned into a bacterial host.

Methylation Sensitivity

The table below summarizes methylation sensitivity for NEB restriction enzymes, indicating whether or not cleavage is blocked or impaired by Dam, Dcm or CpG methylation if or when it overlaps each recognition site. This table should be viewed as a guide to the behavior of the enzymes listed rather than an absolute indicator. Consult REBASE , the restriction enzyme database, for more detailed information and specific examples upon which these guidelines are based.

References

  1. Marinus, M.G. and Morris, N.R. (1973) J. Bacteriol. 114, 1143–1150. PMID: 4576399
  2. Geier, G.E.and Modrich, P. (1979) J. Biol. Chem. 254, 1408–1413. PMID: 368070
  3. May, M.S. and Hattman, S.(1975) J. Bacteriol. 123, 768–770. PMID: 1097428
  4. Siegfried, Z. and Cedar, H. (1997) Curr. Biol. 7, r305–307. PMID: 9115385

Legend

● Not Sensitive ◆ Impaired
◼ Blocked ◇ ol Impaired by Overlapping
◻ ol Blocked by Overlapping ◇ scol Impaired by Some Combinations of Overlapping
◻ scol Blocked by Some Combinations of Overlapping
Single Letter Code
Enzyme Sequence Dam Dcm Cpg
AatII GACGT/C ● ● ■
AccI GT/MKAC ● ● ◻ ol
Acc65I G/GTACC ● ◻ scol ◻ scol
AciI CCGC(-3/-1) ● ● ■
AclI AA/CGTT ● ● ■
AcuI CTGAAG(16/14) ● ● ●
AfeI AGC/GCT ● ● ■
AflII C/TTAAG ● ● ●
AflIII A/CRYGT ● ● ●
AgeI-HF® A/CCGGT ● ● ■
AhdI GACNNN/NNGTC ● ● ◇ scol
AleI-v2 CACNN/NNGTG ● ● ◇ ol
AluI AG/CT ● ● ●
AlwI GGATC(4/5) ■ ● ●
AlwNI CAGNNN/CTG ● ◻ ol ●
ApaI GGGCC/C ● ◻ ol ◻ ol
ApaLI G/TGCAC ● ● ◻ ol
ApeKI G/CWGC ● ● ◻ ol
ApoI-HF R/AATTY ● ● ●
AscI GG/CGCGCC ● ● ■
AseI AT/TAAT ● ● ●
AsiSI GCGAT/CGC ● ● ■
AvaI C/YCGRG ● ● ■
AvaII G/GWCC ● ◻ ol ◻ ol
AvrII C/CTAGG ● ● ●
BaeGI GKGCM/C ● ● ●
BaeI (10/15)ACNNNNGTAYC(12/7) ● ● ◻ scol
BamHI § G/GATCC ● ● ●
BamHI-HF® G/GATCC ● ● ●
BanI G/GYRCC ● ◻ scol ◻ scol
BanII GRGCY/C ● ● ●
BbsI § GAAGAC(2/6) ● ● ●
BbsI-HF® GAAGAC(2/6) ● ● ●
BbvCI CCTCAGC(-5/-2) ● ● ◇ ol
BbvI GCAGC(8/12) ● ● ●
BccI CCATC(4/5) ● ● ●
BceAI ACGGC(12/14) ● ● ■
BcgI (10/12)CGANNNNNNTGC(12/10) ◇ ol ● ◻ scol
BciVI GTATCC(6/5) ● ● ●
BclI § T/GATCA ■ ● ●
BclI-HF T/GATCA ■ ● ●
BcoDI GTCTC(1/5) ● ● ◇ scol
BfaI C/TAG ● ● ●
BfuAI ACCTGC(4/8) ● ● ◇ ol
BglI GCCNNNN/NGGC ● ● ◻ scol
BglII A/GATCT ● ● ●
BlpI GC/TNAGC ● ● ●
BmgBI CACGTC(-3/-3) ● ● ■
BmrI ACTGGG(5/4) ● ● ●
BmtI-HF® GCTAG/C ● ● ●
BpmI CTGGAG(16/14) ● ● ●
BpuEI CTTGAG(16/14) ● ● ●
Bpu10I CCTNAGC(-5/-2) ● ● ●
BsaAI YAC/GTR ● ● ■
BsaBI GATNN/NNATC ◻ ol ● ◻ scol
BsaHI GR/CGYC ● ◻ scol ■
BsaI-HF®v2 GGTCTC(1/5) ● ◇ scol ◻ scol
BsaJI C/CNNGG ● ● ●
BsaWI W/CCGGW ● ● ●
BsaXI (9/12)ACNNNNNCTCC(10/7) ● ● ●
BseRI GAGGAG(10/8) ● ● ●
BseYI CCCAGC(-5/-1) ● ● ◻ ol
BsgI GTGCAG(16/14) ● ● ●
BsiEI CGRY/CG ● ● ■
BsiHKAI GWGCW/C ● ● ●
BsiWI § C/GTACG ● ● ■
BsiWI-HF® C/GTACG ● ● ■
BslI CCNNNNN/NNGG ● ◻ scol ◻ scol
BsmAI GTCTC(1/5) ● ● ◻ scol
BsmBI-v2 CGTCTC ● ● ■
BsmFI GGGAC(10/14) ● ◻ ol ◻ ol
BsmI GAATGC(1/-1) ● ● ●
BsoBI C/YCGRG ● ● ●
BspCNI CTCAG(9/7) ● ● ●
BspDI AT/CGAT ◻ ol ● ■
BspEI T/CCGGA ◻ ol ● ◆
BspHI T/CATGA ◇ ol ● ●
Bsp1286I GDGCH/C ● ● ●
BspMI ACCTGC(4/8) ● ● ●
BspQI GCTCTTC(1/4) ● ● ●
BspQI-HF® § GCTCTTC(1/4) ● ● ●
BsrBI CCGCTC(-3/-3) ● ● ◻ scol
BsrDI GCAATG(2/0) ● ● ●
BsrFI-v2 R/CCGGY ● ● ■
BsrGI-HF® T/GTACA ● ● ●
BsrI ACTGG(1/-1) ● ● ●
BssHII G/CGCGC ● ● ■
BssSI-v2 CACGAG(-5/-1) ● ● ●
BstAPI GCANNNN/NTGC ● ● ◻ scol
BstBI TT/CGAA ● ● ■
BstEII-HF® G/GTNACC ● ● ●
BstNI CC/WGG ● ● ●
BstUI CG/CG ● ● ■
BstXI CCANNNNN/NTGG ● ◻ scol ●
BstYI R/GATCY ● ● ●
BstZ17I-HF® GTATAC ● ● ◻ scol
Bsu36I CC/TNAGG ● ● ●
BtgI C/CRYGG ● ● ●
BtgZI GCGATG(10/14) ● ● ◆
BtsCI GGATG(2/0) ● ● ●
BtsIMutI CAGTG(2/0) ● ● ●
BtsI-v2 GCAGTG(2/0) ● ● ●
Cac8I GCN/NGC ● ● ◻ scol
ClaI AT/CGAT ◻ ol ● ■
CspCI (11/13)CAANNNNNGTGG(12/10) ● ● ●
CviKI-1 RG/CY ● ● ●
CviQI G/TAC ● ● ●
DdeI C/TNAG ● ● ●
DpnI GA/TC ● ● ◻ ol
DpnII /GATC ■ ● ●
DraI TTT/AAA ● ● ●
DraIII-HF® CACNNN/GTG ● ● ◇ ol
DrdI GACNNNN/NNGTC ● ● ◻ scol
EaeI Y/GGCCR ● ◻ ol ◻ ol
EagI-HF® C/GGCCG ● ● ■
EarI CTCTTC(1/4) ● ● ◇ ol
EciI GGCGGA(11/9) ● ● ◻ scol
Eco53kI GAG/CTC ● ● ◻ scol
EcoNI CCTNN/NNNAGG ● ● ●
EcoO109I RG/GNCCY ● ◻ ol ●
EcoP15I CAGCAG(25/27) ● ● ●
EcoRI § G/AATTC ● ● ◻ scol
EcoRI-HF® G/AATTC ● ● ◻ scol
EcoRV § GAT/ATC ● ● ◇ scol
EcoRV-HF® GAT/ATC ● ● ◇ scol
Esp3I CGTCTC(1/5) ● ● ■
FatI /CATG ● ● ●
FauI CCCGC(4/6) ● ● ■
Fnu4HI GC/NGC ● ● ◻ ol
FokI GGATG(9/13) ● ◇ ol ◇ ol
FseI GGCCGG/CC ● ◇ scol ■
FspI TGC/GCA ● ● ■
HaeII RGCGC/Y ● ● ■
HaeIII GG/CC ● ● ●
HgaI GACGC(5/10) ● ● ■
HhaI GCG/C ● ● ■
HincII GTY/RAC ● ● ◻ scol
HindIII § A/AGCTT ● ● ●
HindIII-HF® A/AGCTT ● ● ●
HinfI G/ANTC ● ● ◻ scol
HinP1I G/CGC ● ● ■
HpaI GTT/AAC ● ● ◻ scol
HpaII C/CGG ● ● ■
HphI GGTGA(8/7) ■ ■ ●
HpyAV CCTTC(6/5) ● ● ◇ ol
HpyCH4III ACN/GT ● ● ●
HpyCH4IV A/CGT ● ● ■
HpyCH4V TG/CA ● ● ●
Hpy188I TCN/GA ◻ ol ● ●
Hpy99I CGWCG/ ● ● ■
Hpy166II GTN/NAC ● ● ◻ ol
Hpy188III TC/NNGA ◻ ol ● ◻ ol
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceI TAGGGATAACAGGGTAAT(-9/-13)
KasI G/GCGCC ● ● ■
KpnI-HF® GGTAC/C ● ● ●
MboI /GATC ■ ● ●
MboII GAAGA(8/7) ◻ ol ● ●
MfeI-HF® C/AATTG ● ● ●
MluCI /AATT ● ● ●
MluI-HF® A/CGCGT ● ● ■
MlyI GAGTC(5/5) ● ● ●
MmeI TCCRAC(20/18) ● ● ◻ ol
MnlI CCTC(7/6) ● ● ●
MscI TGG/CCA ● ◻ ol ●
MseI T/TAA ● ● ●
MslI CAYNN/NNRTG ● ● ●
MspA1I CMG/CKG ● ● ◻ ol
MspI C/CGG ● ● ●
MspJI CNNR(9/13) ● ● ●
MwoI GCNNNNN/NNGC ● ● ◻ scol
NaeI GCC/GGC ● ● ■
NarI GG/CGCC ● ● ■
Nb.BbvCI CCTCAGC(none/-2) ● ● ●
Nb.BsmI GAATGC(none/-1) ● ● ●
Nb.BsrDI GCAATG(none/0) ● ● ●
Nb.BssSI CACGAG(none/-1) ● ● ●
Nb.BtsI GCAGTG(none/0) ● ● ●
NciI CC/SGG ● ● ◇ ol
NcoI § C/CATGG ● ● ●
NcoI-HF® C/CATGG ● ● ●
NdeI CA/TATG ● ● ●
NgoMIV G/CCGGC ● ● ■
NheI-HF® G/CTAGC ● ● ◻ scol
NlaIII CATG/ ● ● ●
NlaIV GGN/NCC ● ◻ ol ◻ ol
NmeAIII GCCGAG(21/19) ● ● ●
NotI § GC/GGCCGC ● ● ■
NotI-HF® GC/GGCCGC ● ● ■
NruI-HF® TCG/CGA ◻ ol ● ■
NsiI § ATGCA/T ● ● ●
NsiI-HF® ATGCA/T ● ● ●
NspI RCATG/Y ● ● ●
Nt.AlwI GGATC(4/none) ■ ● ●
Nt.BbvCI CCTCAGC(-5/none) ● ● ◻ scol
Nt.BsmAI GTCTC(1/none) ● ● ■
Nt.BspQI GCTCTTC(1/none) ● ● ●
Nt.BstNBI GAGTC(4/none) ● ● ●
Nt.CviPII CCD(-3/none) ● ● ■
PacI TTAAT/TAA ● ● ●
PaeR7I C/TCGAG ● ● ■
PaqCI CACCTGC(4/8) ● ● ◇ ol
PciI A/CATGT ● ● ●
PflFI GACN/NNGTC ● ● ●
PflMI CCANNNN/NTGG ● ◻ ol ●
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
PleI GAGTC(4/5) ● ● ◻ scol
PluTI GGCGC/C ● ● ■
PmeI GTTT/AAAC ● ● ◻ scol
PmlI CAC/GTG ● ● ■
PpuMI RG/GWCCY ● ◻ ol ●
PshAI GACNN/NNGTC ● ● ◻ scol
PsiI-v2 TTA/TAA ● ● ●
PspGI /CCWGG ● ■ ●
PspOMI G/GGCCC ● ◇ scol ◻ ol
PspXI VC/TCGAGB ● ● ◆
PstI § CTGCA/G ● ● ●
PstI-HF® CTGCA/G ● ● ●
PvuI-HF® CGAT/CG ● ● ■
PvuII § CAG/CTG ● ● ●
PvuII-HF® CAG/CTG ● ● ●
RsaI GT/AC ● ● ◻ scol
RsrII CG/GWCCG ● ● ■
SacI-HF® GAGCT/C ● ● ◻ scol
SacII CCGC/GG ● ● ■
SalI § G/TCGAC ● ● ■
SalI-HF® G/TCGAC ● ● ■
SapI GCTCTTC(1/4) ● ● ●
Sau3AI /GATC ● ● ◻ ol
Sau96I G/GNCC ● ◻ ol ◻ ol
SbfI-HF® CCTGCA/GG ● ● ●
ScaI-HF® AGT/ACT ● ● ●
ScrFI CC/NGG ● ◻ ol ◻ ol
SexAI A/CCWGGT ● ■ ●
SfaNI GCATC(5/9) ● ● ◇ scol
SfcI C/TRYAG ● ● ●
SfiI GGCCNNNN/NGGCC ● ◇ ol ◻ scol
SfoI GGC/GCC ● ◻ scol ■
SgrAI CR/CCGGYG ● ● ■
SmaI CCC/GGG ● ● ■
SmlI C/TYRAG ● ● ●
SnaBI TAC/GTA ● ● ■
SpeI-HF® A/CTAGT ● ● ●
SphI § GCATG/C ● ● ●
SphI-HF® GCATG/C ● ● ●
SrfI GCCC/GGGC ● ● ■
SspI-HF® AAT/ATT ● ● ●
StuI AGG/CCT ● ◻ ol ●
StyD4I /CCNGG ● ◻ ol ◇ ol
StyI-HF® C/CWWGG ● ● ●
SwaI ATTT/AAAT ● ● ●
TaqI-v2 T/CGA ◻ ol ● ●
TfiI G/AWTC ● ● ◻ scol
TseI G/CWGC ● ● ◻ scol
Tsp45I /GTSAC ● ● ●
TspMI C/CCGGG ● ● ■
TspRI NNCASTGNN/ ● ● ●
Tth111I GACN/NNGTC ● ● ●
WarmStart® Nt.BstNBI GAGTC(4/none) ● ● ●
XbaI T/CTAGA ◻ ol ● ●
XcmI CCANNNNN/NNNNTGG ● ● ●
XhoI C/TCGAG ● ● ◆
XmaI C/CCGGG ● ● ◆
XmnI GAANN/NNTTC ● ● ●
ZraI GAC/GTC ● ● ■

§ An HF version of this enzyme is available.

)
Loading Spinner