NEBuffer Activity/Performance Chart with Restriction Enzymes

NEB’s restriction enzyme buffer system makes your restriction digests easy and convenient. We are able to offer >210 restriction enzymes that cut in a single buffer, CutSmart® . This improves ease-of-use, especially when performing double digests. In addition to indicating the performance of each enzyme in the 4 NEBuffers, the chart also indicates ligation and recutting, star activity, and whether or not more than 1-site is required for cleavage.

Should you require information on the pre-2013 buffer system, please refer to the old NEBuffer Activity Chart. You can also receive additional support by contacting info@neb.com.

 

Legend

Not Sensitive   Impaired
Blocked Impaired by Overlapping
Blocked by Overlapping Impaired by Some Combinations of Overlapping
Blocked by Some Combinations of Overlapping

Please check out other technical reference information related to restriction enzymes:
Double Digestion | Heat Inactivation | Activity at 37°C | Diluent Buffers | Time-Saver Enzymes | High Fidelity (HF) Restriction Enzymes 

Chart Notes | Icon Descriptions | Single Letter Code

Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
AatII     GACGT/C CutSmart® Buffer 10 50* 50 100 80°C 37°C B blocked λ DNA
AbaSI   CutSmart® Buffer 25 50 50 100 65°C 25°C C not sensitive T4 wild-type phage DNA (fully ghmC-modified) e
AccI     GT/MKAC CutSmart® Buffer 50 50 10 100 80°C 37°C A Blocked by Overlapping λ DNA
Acc65I      G/GTACC NEBuffer™ 3.1 10 75* 100 25 65°C 37°C A Blocked by Some Combinations of Overlapping pBC4 DNA
AciI     CCGC(-3/-1) CutSmart® Buffer 10 25 100 100 65°C 37°C A blocked λ DNA
AclI     AA/CGTT CutSmart® Buffer 10 10 10 100 No 37°C B blocked λ DNA
AcuI    CTGAAG(16/14) CutSmart® Buffer + SAM 50 100 50 100 65°C 37°C B λ DNA 1, b, d
AfeI   AGC/GCT CutSmart® Buffer 25 100 25 100 65°C 37°C B pXba DNA
AflII    C/TTAAG CutSmart® Buffer 50 100 10 100 65°C 37°C A not sensitive ΦX174 RF I DNA
AflIII   A/CRYGT NEBuffer™ 3.1 10 50 100 50 80°C 37°C B not sensitive λ DNA
AgeI §    A/CCGGT NEBuffer™ 1.1 100 75 25 75 65°C 37°C C blocked λ DNA
AgeI-HF®      A/CCGGT CutSmart® Buffer 100 50 10 100 65°C 37°C A blocked λ DNA
AhdI     GACNNN/NNGTC CutSmart® Buffer 25 25 10 100 65°C 37°C A Impaired by Some Combinations of Overlapping λ DNA a
AleI    CACNN/NNGTG CutSmart® Buffer 10 10 10 100 80°C 37°C B Impaired by Some Combinations of Overlapping λ DNA
AluI    AG/CT CutSmart® Buffer 25 100 50 100 80°C 37°C B not sensitive λ DNA b
AlwI    GGATC(4/5) CutSmart® Buffer 50 50 10 100 No 37°C A not sensitive λ DNA (dam-) 1, b, d
AlwNI     CAGNNN/CTG CutSmart® Buffer 10 100 50 100 80°C 37°C A not sensitive λ DNA
ApaI      GGGCC/C CutSmart® Buffer 25 25 10 100 65°C 25°C A Blocked by Overlapping pXba DNA
ApaLI     G/TGCAC CutSmart® Buffer 100 100 10 100 No 37°C A Blocked by Overlapping λ DNA (HindIII digest)
ApeKI     G/CWGC NEBuffer™ 3.1 25 50 100 10 No 75°C B Blocked by Overlapping λ DNA
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
ApoI §    R/AATTY NEBuffer™ 3.1 10 75 100 75 80°C 50°C A not sensitive λ DNA
ApoI-HF     R/AATTY CutSmart® Buffer 10 100 10 100 80°C 37°C B not sensitive
AscI     GG/CGCGCC CutSmart® Buffer 10 10 10 100 80°C 37°C A blocked λ DNA
AseI    AT/TAAT NEBuffer™ 3.1 10 50* 100 10 65°C 37°C B not sensitive λ DNA 3
AsiSI    GCGAT/CGC CutSmart® Buffer 100 100 25 100 80°C 37°C B blocked XhoI digested pXba 2, b
AvaI     C/YCGRG CutSmart® Buffer 10 100 25 100 80°C 37°C A blocked λ DNA
AvaII      G/GWCC CutSmart® Buffer 50 75 10 100 80°C 37°C A Blocked by Overlapping λ DNA
AvrII    C/CTAGG CutSmart® Buffer 100 50 50 100 No 37°C B not sensitive λ DNA (HindIII digest)
BaeGI    GKGCM/C NEBuffer™ 3.1 75 75 100 25 80°C 37°C A not sensitive λ DNA
BaeI     (10/15)ACNNNNGTAYC(12/7) CutSmart® Buffer + SAM 50 100 50 100 65°C 25°C A Blocked by Some Combinations of Overlapping pXba DNA e
BamHI §    G/GATCC NEBuffer™ 3.1 75* 100* 100 100* No 37°C A not sensitive λ DNA 3
BamHI-HF®     G/GATCC CutSmart® Buffer 100 50 10 100 No 37°C A not sensitive λ DNA
BanI     G/GYRCC CutSmart® Buffer 10 25 10 100 65°C 37°C A Blocked by Some Combinations of Overlapping λ DNA 1
BanII   GRGCY/C CutSmart® Buffer 100 100 50 100 80°C 37°C A not sensitive λ DNA 2
BbsI §    GAAGAC(2/6) NEBuffer™ 2.1 100 100 25 75 65°C 37°C B not sensitive λ DNA
BbsI-HF®     GAAGAC(2/6) CutSmart® Buffer 10 10 10 100 65°C 37°C B not sensitive λ DNA
BbvCI    CCTCAGC(-5/-2) CutSmart® Buffer 10 100 50 100 No 37°C B Impaired by Overlapping λ DNA 1, a
BbvI    GCAGC(8/12) CutSmart® Buffer 100 100 25 100 65°C 37°C B pBR322 (dcm+) DNA 3
BccI   CCATC(4/5) CutSmart® Buffer 100 50 10 100 65°C 37°C A not sensitive pXba DNA 3, b
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
BceAI    ACGGC(12/14) NEBuffer™ 3.1 100* 100* 100 100* 65°C 37°C A blocked pBR322 (dcm+) DNA 1
BcgI   (10/12)CGANNNNNNTGC(12/10) NEBuffer™ 3.1 + SAM 10 75* 100 50* 65°C 37°C A λ DNA e
BciVI    GTATCC(6/5) CutSmart® Buffer 100 25 10 100 80°C 37°C C not sensitive λ DNA b
BclI     T/GATCA NEBuffer™ 3.1 50 100 100 75 No 50°C A not sensitive λ DNA (dam-)
BclI-HF      T/GATCA CutSmart® Buffer 100 100 10 100 65°C 37°C B not sensitive 3
BcoDI     GTCTC(1/5) CutSmart® Buffer 50 75 75 100 No 37°C B Impaired by Some Combinations of Overlapping λ DNA
BfaI   C/TAG CutSmart® Buffer 10 10 10 100 80°C 37°C B not sensitive λ DNA 2, b
BfuAI     ACCTGC(4/8) NEBuffer™ 3.1 10 25 100 10 65°C 50°C B Impaired by Overlapping λ DNA 3
BfuCI    /GATC CutSmart® Buffer 100 50 25 100 80°C 37°C B Blocked by Overlapping λ DNA
BglI     GCCNNNN/NGGC NEBuffer™ 3.1 10 25 100 10 65°C 37°C B Blocked by Some Combinations of Overlapping λ DNA
BglII    A/GATCT NEBuffer™ 3.1 10 10 100 10 No 37°C A not sensitive λ DNA
BlpI    GC/TNAGC CutSmart® Buffer 50 100 10 100 No 37°C A not sensitive λ DNA d
BmgBI    CACGTC(-3/-3) NEBuffer™ 3.1 10 10 100 10 65°C 37°C B λ DNA 3, b, d
BmrI   ACTGGG(5/4) NEBuffer™ 2.1 75 100 75 100* 65°C 37°C B not sensitive λ DNA (HindIII digest) b
BmtI §   GCTAG/C NEBuffer™ 3.1 100 100 100 100 65°C 37°C B not sensitive pXba DNA 2
BmtI-HF®     GCTAG/C CutSmart® Buffer 50 100 10 100 65°C 37°C B not sensitive pXba DNA
BpmI   CTGGAG(16/14) NEBuffer™ 3.1 75 100 100 100 65°C 37°C B not sensitive λ DNA 2
BpuEI    CTTGAG(16/14) CutSmart® Buffer + SAM 50* 100 50* 100 65°C 37°C B not sensitive λ DNA d
Bpu10I   CCTNAGC(-5/-2) NEBuffer™ 3.1 10 25 100 25 80°C 37°C B not sensitive λ DNA 3, b, d
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
BsaAI     YAC/GTR CutSmart® Buffer 100 100 100 100 No 37°C C blocked λ DNA
BsaBI     GATNN/NNATC CutSmart® Buffer 50 100 75 100 80°C 60°C B Blocked by Some Combinations of Overlapping λ DNA (dam-) 2
BsaHI      GR/CGYC CutSmart® Buffer 50 100 100 100 80°C 37°C C blocked λ DNA
BsaI §     GGTCTC(1/5) CutSmart® Buffer 75* 75 100 100 65°C 37°C B Blocked by Some Combinations of Overlapping pXba DNA 3
BsaI-HF®       GGTCTC(1/5) CutSmart® Buffer 50 100 25 100 65°C 37°C B Blocked by Some Combinations of Overlapping pXba DNA
BsaJI   C/CNNGG CutSmart® Buffer 50 100 100 100 80°C 60°C A not sensitive λ DNA
BsaWI    W/CCGGW CutSmart® Buffer 10 100 50 100 80°C 60°C A not sensitive λ DNA
BsaXI   (9/12)ACNNNNNCTCC(10/7) CutSmart® Buffer 50* 100* 10 100 No 37°C C not sensitive λ DNA e
BseRI    GAGGAG(10/8) CutSmart® Buffer 100* 100 75 100 80°C 37°C A not sensitive λ DNA d
BseYI    CCCAGC(-5/-1) NEBuffer™ 3.1 10 50 100 50 80°C 37°C B Blocked by Overlapping λ DNA d
BsgI    GTGCAG(16/14) CutSmart® Buffer + SAM 25 50 25 100 65°C 37°C B not sensitive λ DNA d
BsiEI     CGRY/CG CutSmart® Buffer 25 50 10 100 No 60°C A blocked λ DNA
BsiHKAI   GWGCW/C CutSmart® Buffer 25 100 100 100 No 65°C A not sensitive λ DNA
BsiWI §     C/GTACG NEBuffer™ 3.1 25 50* 100 25 65°C 55°C B blocked ΦX174 DNA
BsiWI-HF®      C/GTACG CutSmart® Buffer 50 100 10 100 No 37°C B blocked
BslI      CCNNNNN/NNGG CutSmart® Buffer 50 75 100 100 No 55°C A Blocked by Some Combinations of Overlapping λ DNA b
BsmAI     GTCTC(1/5) CutSmart® Buffer 50 100 100 100 No 55°C B Blocked by Some Combinations of Overlapping λ DNA
BsmBI     CGTCTC(1/5) NEBuffer™ 3.1 10 50* 100 25 80°C 55°C B blocked λ DNA
BsmFI     GGGAC(10/14) CutSmart® Buffer 25 50 50 100 80°C 65°C A Blocked by Overlapping pBR322 (dcm+) DNA 1
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
BsmI    GAATGC(1/-1) CutSmart® Buffer 25 100 10 100 80°C 65°C A not sensitive λ DNA
BsoBI    C/YCGRG CutSmart® Buffer 25 100 100 100 80°C 37°C A not sensitive λ DNA
BspCNI    CTCAG(9/7) CutSmart® Buffer + SAM 100 75 10 100 80°C 25°C A not sensitive λ DNA b
BspDI     AT/CGAT CutSmart® Buffer 25 75 50 100 80°C 37°C A blocked λ DNA
BspEI      T/CCGGA NEBuffer™ 3.1 10 10 100 10 80°C 37°C B Impaired λ DNA (dam-)
BspHI     T/CATGA CutSmart® Buffer 10 50 25 100 80°C 37°C A not sensitive λ DNA
Bsp1286I    GDGCH/C CutSmart® Buffer 25 25 25 100 65°C 37°C A not sensitive λ DNA 3
BspMI   ACCTGC(4/8) NEBuffer™ 3.1 10 50* 100 10 65°C 37°C B not sensitive λ DNA
BspQI    GCTCTTC(1/4) NEBuffer™ 3.1 100 100 100 100 80°C 50°C B not sensitive λ DNA 3
BsrBI     CCGCTC(-3/-3) CutSmart® Buffer 50 100 100 100 80°C 37°C A Blocked by Some Combinations of Overlapping λ DNA d
BsrDI    GCAATG(2/0) NEBuffer™ 2.1 10 100 75 25 80°C 65°C A not sensitive λ DNA 3, d
BsrFαI      R/CCGGY CutSmart® Buffer 25 25 0 100 No 37°C C blocked
BsrGI §    T/GTACA NEBuffer™ 2.1 25 100 100 25 80°C 37°C A not sensitive λ DNA
BsrGI-HF®     T/GTACA CutSmart® Buffer 10 100 100 100 80°C 37°C A not sensitive λ DNA
BsrI   ACTGG(1/-1) NEBuffer™ 3.1 10 50 100 10 80°C 65°C B not sensitive ΦX174 RF I DNA b
BssHII     G/CGCGC CutSmart® Buffer 100 100 100 100 65°C 50°C B blocked λ DNA
BssSαI     CACGAG(-5/-1) CutSmart® Buffer 10 25 10 100 No 37°C B not sensitive λ DNA
BstAPI    GCANNNN/NTGC CutSmart® Buffer 50 100 25 100 80°C 60°C A Blocked by Some Combinations of Overlapping λ DNA b
BstBI     TT/CGAA CutSmart® Buffer 75 100 10 100 No 65°C A blocked λ DNA
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
BstEII  §    G/GTNACC NEBuffer™ 3.1 10 75* 100 75* No 60°C A not sensitive λ DNA 3
BstEII-HF®     G/GTNACC CutSmart® Buffer 10 10 10 100 No 37°C A not sensitive λ DNA
BstNI    CC/WGG NEBuffer™ 3.1 10 100 100 75 No 60°C A not sensitive λ DNA a
BstUI    CG/CG CutSmart® Buffer 50 100 25 100 No 60°C A blocked λ DNA b
BstXI     CCANNNNN/NTGG NEBuffer™ 3.1 10 50 100 25 80°C 37°C B not sensitive λ DNA 3
BstYI    R/GATCY NEBuffer™ 2.1 25 100 75 100 No 60°C A not sensitive λ DNA
BstZ17I-HF®      GTATAC CutSmart® Buffer 100 100 10 100 No 37°C A Blocked by Some Combinations of Overlapping λ DNA
Bsu36I    CC/TNAGG CutSmart® Buffer 25 100 100 100 80°C 37°C C not sensitive λ DNA (HindIII digest) b
BtgI    C/CRYGG CutSmart® Buffer 50 100 100 100 80°C 37°C B not sensitive pBR322 (dcm+) DNA
BtgZI    GCGATG(10/14) CutSmart® Buffer 10 25 10 100 80°C 60°C A Impaired λ DNA 3, b, d
BtsαI     GCAGTG(2/0) CutSmart® Buffer 100 100 25 100 No 55°C A not sensitive λ DNA
BtsCI    GGATG(2/0) CutSmart® Buffer 10 100 25 100 80°C 50°C B not sensitive λ DNA
BtsIMutI    CAGTG(2/0) CutSmart® Buffer 100 50 10 100 80°C 55°C A not sensitive pUC19 DNA b
Cac8I    GCN/NGC CutSmart® Buffer 50 75 100 100 65°C 37°C B Blocked by Some Combinations of Overlapping λ DNA b
ClaI      AT/CGAT CutSmart® Buffer 10 50 50 100 65°C 37°C A blocked λ DNA (dam-)
CspCI    (11/13)CAANNNNNGTGG(12/10) CutSmart® Buffer + SAM 10 100 10 100 65°C 37°C A λ DNA e
CviAII    C/ATG CutSmart® Buffer 50 50 10 100 65°C 25°C C not sensitive λ DNA
CviKI-1   RG/CY CutSmart® Buffer 25 100 100 100 No 37°C A not sensitive pBR322 (dcm+) DNA 1, b
CviQI    G/TAC NEBuffer™ 3.1 75 100* 100 75* No 25°C C not sensitive λ DNA b
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
DdeI    C/TNAG CutSmart® Buffer 75 100 100 100 65°C 37°C B not sensitive λ DNA
DpnI     GA/TC CutSmart® Buffer 100 100 75 100 80°C 37°C B Blocked by Overlapping pBR322 DNA (dam methylated) b
DpnII    /GATC NEBuffer DpnII 25 25 100* 25 65°C 37°C B λ DNA (dam-)
DraI    TTT/AAA CutSmart® Buffer 75 75 50 100 65°C 37°C A not sensitive λ DNA
DraIII-HF®      CACNNN/GTG CutSmart® Buffer 10 50 10 100 No 37°C B Impaired by Overlapping λ DNA b
DrdI    GACNNNN/NNGTC CutSmart® Buffer 25 50 10 100 65°C 37°C A Blocked by Some Combinations of Overlapping pUC19 DNA 3
EaeI     Y/GGCCR CutSmart® Buffer 10 50 10 100 65°C 37°C A Blocked by Overlapping λ DNA b
EagI §     C/GGCCG NEBuffer™ 3.1 10 25 100 10 65°C 37°C B blocked pXba DNA
EagI-HF®      C/GGCCG CutSmart® Buffer 25 100 100 100 65°C 37°C B blocked pXba DNA
EarI     CTCTTC(1/4) CutSmart® Buffer 50 10 10 100 65°C 37°C B Impaired by Overlapping λ DNA b, d
EciI    GGCGGA(11/9) CutSmart® Buffer 100 50 50 100 65°C 37°C A Blocked by Some Combinations of Overlapping λ DNA 2
Eco53kI     GAG/CTC CutSmart® Buffer 100 100 10 100 65°C 37°C A Blocked by Some Combinations of Overlapping pXba DNA 3, b
EcoNI    CCTNN/NNNAGG CutSmart® Buffer 50 100 75 100 65°C 37°C A not sensitive λ DNA b
EcoO109I    RG/GNCCY CutSmart® Buffer 50 100 50 100 65°C 37°C A λ DNA (HindIII digest) 3
EcoP15I    CAGCAG(25/27) NEBuffer™ 3.1 + ATP 75 100 100 100 65°C 37°C A not sensitive pUC19 DNA e
EcoRI §     G/AATTC NEBuffer™ EcoRI 25 100* 50 50* 65°C 37°C C Blocked by Some Combinations of Overlapping λ DNA
EcoRI-HF®      G/AATTC CutSmart® Buffer 10 100 10 100 65°C 37°C C Blocked by Some Combinations of Overlapping λ DNA
EcoRV §     GAT/ATC NEBuffer™ 3.1 10 50 100 10 80°C 37°C A Impaired by Some Combinations of Overlapping λ DNA
EcoRV-HF®      GAT/ATC CutSmart® Buffer 25 100 100 100 65°C 37°C B Impaired by Some Combinations of Overlapping λ DNA
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
FatI   /CATG NEBuffer™ 2.1 10 100 50 50 80°C 55°C A not sensitive pUC19 DNA
FauI    CCCGC(4/6) CutSmart® Buffer 100 50 10 100 65°C 55°C A blocked λ DNA 3, b, d
Fnu4HI     GC/NGC CutSmart® Buffer 10 10 10 100 No 37°C A Blocked by Overlapping λ DNA a
FokI     GGATG(9/13) CutSmart® Buffer 100 100 75 100 65°C 37°C A Impaired by Overlapping λ DNA 3, b, d
FseI      GGCCGG/CC CutSmart® Buffer 100 75 10 100 65°C 37°C B blocked Adenovirus-2 DNA
FspEI   CC(12/16) CutSmart® Buffer 10 10 10 100 80°C 37°C B not sensitive pBR322 (dcm+) DNA e
FspI     TGC/GCA CutSmart® Buffer 10 100 10 100 No 37°C C blocked λ DNA b
HaeII     RGCGC/Y CutSmart® Buffer 25 100 10 100 80°C 37°C A blocked λ DNA
HaeIII    GG/CC CutSmart® Buffer 50 100 25 100 80°C 37°C A not sensitive λ DNA
HgaI    GACGC(5/10) NEBuffer™ 1.1 100 100 25 100 65°C 37°C A blocked ΦX174 DNA 1
HhaI     GCG/C CutSmart® Buffer 25 100 100 100 65°C 37°C A blocked λ DNA
HincII     GTY/RAC NEBuffer™ 3.1 25 100 100 100 65°C 37°C B Blocked by Some Combinations of Overlapping λ DNA
HindIII §   A/AGCTT NEBuffer™ 2.1 25 100 50 50 80°C 37°C B not sensitive λ DNA 2
HindIII-HF®     A/AGCTT CutSmart® Buffer 10 100 10 100 80°C 37°C B not sensitive λ DNA
HinfI     G/ANTC CutSmart® Buffer 50 100 100 100 80°C 37°C A Blocked by Some Combinations of Overlapping λ DNA
HinP1I     G/CGC CutSmart® Buffer 100 100 100 100 65°C 37°C A blocked λ DNA
HpaI    GTT/AAC CutSmart® Buffer 10 75* 25 100 No 37°C A Blocked by Some Combinations of Overlapping λ DNA 1
HpaII     C/CGG CutSmart® Buffer 100 50 10 100 80°C 37°C A blocked λ DNA
HphI      GGTGA(8/7) CutSmart® Buffer 50 50 10 100 65°C 37°C B not sensitive λ DNA b, d
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
HpyAV     CCTTC(6/5) CutSmart® Buffer 100 100 25 100 65°C 37°C Impaired by Overlapping λ DNA 3, b, d
HpyCH4III   ACN/GT CutSmart® Buffer 100 25 10 100 65°C 37°C A not sensitive λ DNA b
HpyCH4IV     A/CGT CutSmart® Buffer 100 50 25 100 65°C 37°C A blocked pUC19 DNA
HpyCH4V    TG/CA CutSmart® Buffer 50 50 25 100 65°C 37°C A not sensitive λ DNA
Hpy188I    TCN/GA CutSmart® Buffer 25 100 50 100 65°C 37°C A not sensitive pBR322 (dcm+) DNA 1, b
Hpy99I    CGWCG/ CutSmart® Buffer 50 10 10 100 65°C 37°C A blocked λ DNA
Hpy166II     GTN/NAC CutSmart® Buffer 100 100 50 100 65°C 37°C C Blocked by Overlapping pBR322 DNA
Hpy188III     TC/NNGA CutSmart® Buffer 100 100 10 100 65°C 37°C B Blocked by Overlapping pUC19 DNA 3, b
I-CeuI   TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) CutSmart® Buffer 10 10 10 100 65°C 37°C B pBHS ScaI-linearized Control Plasmid
I-SceI   TAGGGATAACAGGGTAAT(-9/-13) CutSmart® Buffer 10 50 25 100 65°C 37°C B pGPS2 NotI-linearized Control Plasmid
KasI    G/GCGCC CutSmart® Buffer 50 100 50 100 65°C 37°C B blocked pBR322 DNA 3
KpnI §   GGTAC/C NEBuffer™ 1.1 100 75 10 50* No 37°C A not sensitive pXba DNA 1
KpnI-HF®     GGTAC/C CutSmart® Buffer 100 25 10 100 No 37°C A pXba DNA
LpnPI   CCDG(10/14) CutSmart® Buffer 10 10 10 100 65°C 37°C B not sensitive pBR322 (dcm+) DNA e
MboI      /GATC CutSmart® Buffer 75 100 100 100 65°C 37°C A Impaired by Overlapping λ DNA (dam-)
MboII    GAAGA(8/7) CutSmart® Buffer 100* 100 50 100 65°C 37°C C not sensitive λ DNA (dam-) b
MfeI §   C/AATTG CutSmart® Buffer 75 50 10 100 No 37°C A λ DNA 2
MfeI-HF®     C/AATTG CutSmart® Buffer 75 25 10 100 No 37°C A not sensitive λ DNA
MluCI    /AATT CutSmart® Buffer 100 10 10 100 No 37°C A not sensitive λ DNA
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
MluI §     A/CGCGT NEBuffer™ 3.1 10 50 100 25 80°C 37°C A blocked λ DNA
MluI-HF®      A/CGCGT CutSmart® Buffer 25 100 100 100 No 37°C A blocked λ DNA
MlyI    GAGTC(5/5) CutSmart® Buffer 50 50 10 100 65°C 37°C A not sensitive λ DNA b, d
MmeI     TCCRAC(20/18) CutSmart® Buffer + SAM 50 100 50 100 65°C 37°C B Blocked by Overlapping ΦX174 DNA b, c
MnlI    CCTC(7/6) CutSmart® Buffer 75 100 50 100 65°C 37°C B not sensitive λ DNA b
MscI    TGG/CCA CutSmart® Buffer 25 100 100 100 80°C 37°C C not sensitive λ DNA
MseI    T/TAA CutSmart® Buffer 75 100 75 100 65°C 37°C A not sensitive λ DNA
MslI    CAYNN/NNRTG CutSmart® Buffer 50 50 10 100 80°C 37°C A not sensitive λ DNA
MspA1I     CMG/CKG CutSmart® Buffer 10 50 10 100 65°C 37°C B Blocked by Overlapping λ DNA
MspI    C/CGG CutSmart® Buffer 75 100 50 100 No 37°C A not sensitive λ DNA
MspJI   CNNR(9/13) CutSmart® Buffer 10 10 10 100 65°C 37°C B not sensitive pBR322 (dcm+) DNA e
MwoI     GCNNNNN/NNGC CutSmart® Buffer 10 100 100 100 No 60°C B Blocked by Some Combinations of Overlapping λ DNA
NaeI    GCC/GGC CutSmart® Buffer 25 25 10 100 No 37°C A blocked pXba DNA b
NarI    GG/CGCC CutSmart® Buffer 100 100 10 100 65°C 37°C A blocked pXba DNA
Nb.BbvCI   CCTCAGC CutSmart® Buffer 25 100 100 100 80°C 37°C A not sensitive supercoiled plasmid DNA e
Nb.BsmI   GAATGC NEBuffer™ 3.1 10 50 100 10 80°C 65°C A not sensitive pBR322 DNA e
Nb.BsrDI   GCAATG CutSmart® Buffer 25 100 100 100 80°C 65°C A not sensitive pUC19 DNA e
Nb.BssSI   CACGAG NEBuffer™ 3.1 10 100 100 25 No 37°C B
Nb.BtsI   GCAGTG CutSmart® Buffer 75 100 75 100 80°C 37°C A not sensitive ΦX174 DNA e
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
NciI     CC/SGG CutSmart® Buffer 100 25 10 100 No 37°C A Impaired by Overlapping λ DNA b
NcoI §    C/CATGG NEBuffer™ 3.1 100 100 100 100 80°C 37°C A not sensitive λ DNA
NcoI-HF®     C/CATGG CutSmart® Buffer 50 100 10 100 80°C 37°C B not sensitive λ DNA
NdeI    CA/TATG CutSmart® Buffer 75 100 100 100 65°C 37°C A not sensitive λ DNA
NgoMIV     G/CCGGC CutSmart® Buffer 100 50 10 100 No 37°C A blocked Adenovirus-2 DNA 1
NheI §     G/CTAGC NEBuffer™ 2.1 100 100 10 100 65°C 37°C C Blocked by Some Combinations of Overlapping λ DNA (HindIII digest)
NheI-HF®      G/CTAGC CutSmart® Buffer 100 25 10 100 80°C 37°C C Blocked by Some Combinations of Overlapping λ DNA (HindIII digest)
NlaIII    CATG/ CutSmart® Buffer 10 10 10 100 65°C 37°C B not sensitive ΦX174 DNA
NlaIV     GGN/NCC CutSmart® Buffer 10 10 10 100 65°C 37°C B Blocked by Overlapping pBR322 DNA
NmeAIII   GCCGAG(21/19) CutSmart® Buffer + SAM 10 10 10 100 65°C 37°C B not sensitive ΦX174 RF I DNA c
NotI §     GC/GGCCGC NEBuffer™ 3.1 10 50 100 25 65°C 37°C C blocked pBC4 DNA
NotI-HF®      GC/GGCCGC CutSmart® Buffer 25 100 25 100 65°C 37°C A blocked pBC4 DNA
NruI §      TCG/CGA NEBuffer™ 3.1 10 10 100 10 No 37°C A blocked λ DNA b
NruI-HF®       TCG/CGA CutSmart® Buffer 0 25 50 100 No 37°C A blocked λ DNA
NsiI §    ATGCA/T NEBuffer™ 3.1 10 75 100 25 65°C 37°C B not sensitive λ DNA
NsiI-HF®     ATGCA/T CutSmart® Buffer 10 20 10 100 80°C 37°C B not sensitive
NspI    RCATG/Y CutSmart® Buffer 100 100 10 100 65°C 37°C A not sensitive λ DNA
Nt.AlwI    GGATC(4/-5) CutSmart® Buffer 10 100 100 100 80°C 37°C A not sensitive pUC101 DNA (dam-/dcm-) e
Nt.BbvCI    CCTCAGC(-5/-7) CutSmart® Buffer 50 100 10 100 80°C 37°C A Blocked by Some Combinations of Overlapping supercoiled plasmid DNA e
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
Nt.BsmAI    GTCTC(1/-5) CutSmart® Buffer 100 50 10 100 65°C 37°C A blocked supercoiled plasmid DNA e
Nt.BspQI   GCTCTTC(1/-7) NEBuffer™ 3.1 10 25 100 10 80°C 50°C B not sensitive pUC19 DNA e
Nt.BstNBI   GAGTC(4/-5) NEBuffer™ 3.1 0 10 100 10 80°C 55°C A not sensitive T7 DNA
PacI    TTAAT/TAA CutSmart® Buffer 100 75 10 100 65°C 37°C A not sensitive pNEB193 DNA
PaeR7I     C/TCGAG CutSmart® Buffer 25 100 10 100 No 37°C A blocked λ DNA (HindIII digest)
PciI   A/CATGT NEBuffer™ 3.1 50 75 100 50* 80°C 37°C B pXba DNA
PflFI    GACN/NNGTC CutSmart® Buffer 25 100 25 100 65°C 37°C A pBC4 DNA b
PflMI     CCANNNN/NTGG NEBuffer™ 3.1 0 100 100 50 65°C 37°C A not sensitive λ DNA 3, b, d
PI-PspI   TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) NEBuffer™ PI-PspI + BSA 10 10 10 10 No 65°C B pAKR7 XmnI-linearized Control Plasmid
PI-SceI   ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) NEBuffer PI-SceI + BSA 10 10 10 10 65°C 37°C B pBSvdeX XmnI-linearized Control Plasmid
PleI    GAGTC(4/5) CutSmart® Buffer 25 50 25 100 65°C 37°C A Blocked by Some Combinations of Overlapping λ DNA b, d
PluTI    GGCGC/C CutSmart® Buffer 100 25 10 100 65°C 37°C A blocked pXba DNA b
PmeI     GTTT/AAAC CutSmart® Buffer 10 50 10 100 65°C 37°C A Blocked by Some Combinations of Overlapping λ DNA
PmlI     CAC/GTG CutSmart® Buffer 100 50 10 100 65°C 37°C A blocked λ DNA (HindIII digest)
PpuMI     RG/GWCCY CutSmart® Buffer 10 10 10 100 No 37°C B not sensitive λ DNA (HindIII digest)
PshAI     GACNN/NNGTC CutSmart® Buffer 25 50 10 100 65°C 37°C A Blocked by Some Combinations of Overlapping λ DNA
PsiI   TTA/TAA CutSmart® Buffer 10 100 10 100 65°C 37°C B λ DNA 3
PspGI    /CCWGG CutSmart® Buffer 25 100 50 100 No 75°C A not sensitive T7 DNA 3
PspOMI     G/GGCCC CutSmart® Buffer 10 10 10 100 65°C 37°C B Blocked by Overlapping pXba DNA
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
PspXI    VC/TCGAGB CutSmart® Buffer 10 100 25 100 No 37°C B Impaired λ DNA (HindIII digest)
PstI §    CTGCA/G NEBuffer™ 3.1 75 75 100 50* 80°C 37°C C not sensitive λ DNA
PstI-HF®     CTGCA/G CutSmart® Buffer 10 75 50 100 No 37°C C not sensitive λ DNA
PvuI §     CGAT/CG NEBuffer™ 3.1 10 25 100 10 No 37°C B blocked pXba DNA
PvuI-HF®      CGAT/CG CutSmart® Buffer 25 100 100 100 No 37°C B blocked pXba DNA
PvuII §    CAG/CTG NEBuffer™ 3.1 50 100 100 100* No 37°C B not sensitive λ DNA
PvuII-HF®     CAG/CTG CutSmart® Buffer 10 10 10 100 No 37°C B not sensitive λ DNA
RsaI     GT/AC CutSmart® Buffer 25 50 10 100 No 37°C A Blocked by Some Combinations of Overlapping λ DNA
RsrII    CG/GWCCG CutSmart® Buffer 25 75 10 100 65°C 37°C C blocked λ DNA
SacI §    GAGCT/C NEBuffer™ 1.1 100 50 10 100 65°C 37°C A not sensitive λ DNA (HindIII digest)
SacI-HF®      GAGCT/C CutSmart® Buffer 10 50 10 100 65°C 37°C A Blocked by Some Combinations of Overlapping λ DNA (HindIII digest)
SacII     CCGC/GG CutSmart® Buffer 10 100 10 100 65°C 37°C A blocked pXba DNA
SalI §     G/TCGAC NEBuffer™ 3.1 10 10 100 10 65°C 37°C A blocked λ DNA (HindIII digest)
SalI-HF®     G/TCGAC CutSmart® Buffer 10 100 100 100 65°C 37°C A λ DNA (HindIII digest)
SapI    GCTCTTC(1/4) CutSmart® Buffer 75 50 10 100 65°C 37°C B not sensitive λ DNA
Sau3AI    /GATC NEBuffer™ 1.1 100 50 10 100 65°C 37°C A Blocked by Overlapping λ DNA b
Sau96I     G/GNCC CutSmart® Buffer 50 100 100 100 65°C 37°C A Blocked by Overlapping λ DNA
SbfI §    CCTGCA/GG CutSmart® Buffer 50 25 10 100 80°C 37°C A not sensitive λ DNA 3
SbfI-HF®     CCTGCA/GG CutSmart® Buffer 50 25 10 100 80°C 37°C B not sensitive λ DNA
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
ScaI-HF®     AGT/ACT CutSmart® Buffer 100 100 10 100 80°C 37°C B not sensitive λ DNA
ScrFI     CC/NGG CutSmart® Buffer 100 100 100 100 65°C 37°C C Blocked by Overlapping λ DNA 2, a
SexAI    A/CCWGGT CutSmart® Buffer 100 75 50 100 65°C 37°C A not sensitive pBC4 DNA (dcm-) 3, b, d
SfaNI    GCATC(5/9) NEBuffer™ 3.1 10 75 100 25 65°C 37°C B Impaired by Some Combinations of Overlapping ΦX174 RF I DNA 3, b
SfcI   C/TRYAG CutSmart® Buffer 75 50 25 100 65°C 37°C B not sensitive λ DNA 3
SfiI      GGCCNNNN/NGGCC CutSmart® Buffer 25 100 50 100 No 50°C C Blocked by Some Combinations of Overlapping Adenovirus-2 DNA
SfoI      GGC/GCC CutSmart® Buffer 50 100 100 100 No 37°C B blocked λ DNA (HindIII digest)
SgrAI    CR/CCGGYG CutSmart® Buffer 100 100 10 100 65°C 37°C A blocked λ DNA 1
SmaI     CCC/GGG CutSmart® Buffer 10 10 10 100 65°C 25°C B blocked λ DNA (HindIII digest) b
SmlI   C/TYRAG CutSmart® Buffer 25 75 25 100 No 55°C A not sensitive λ DNA b
SnaBI    TAC/GTA CutSmart® Buffer 50* 50 10 100 80°C 37°C A blocked T7 DNA 1
SpeI §    A/CTAGT CutSmart® Buffer 75 100 25 100 80°C 37°C C not sensitive Adenovirus-2 DNA
SpeI-HF®     A/CTAGT CutSmart® Buffer 25 50 10 100 80°C 37°C C not sensitive pXba DNA
SphI §   GCATG/C NEBuffer™ 2.1 100 100 50 100 65°C 37°C B not sensitive λ DNA 2
SphI-HF®     GCATG/C CutSmart® Buffer 50 25 10 100 65°C 37°C B not sensitive λ DNA
SrfI      GCCC/GGGC CutSmart® Buffer 10 50 0 100 65°C 37°C B blocked
SspI §    AAT/ATT NEBuffer SspI 50 100 50 50 65°C 37°C C not sensitive λ DNA
SspI-HF®     AAT/ATT CutSmart® Buffer 25 100 10 100 65°C 37°C B not sensitive λ DNA
StuI     AGG/CCT CutSmart® Buffer 50 100 50 100 No 37°C A not sensitive λ DNA
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
1.1 2.1 3.1 CutSmart
StyD4I      /CCNGG CutSmart® Buffer 10 100 100 100 65°C 37°C B Impaired by Overlapping λ DNA
StyI §    C/CWWGG NEBuffer™ 3.1 10 25 100 10 65°C 37°C A λ DNA b
StyI-HF®     C/CWWGG CutSmart® Buffer 25 100 25 100 65°C 37°C A not sensitive λ DNA
SwaI    ATTT/AAAT NEBuffer™ 3.1 10 10 100 10 65°C 25°C B not sensitive M13mp19 RF I DNA b, d
TaqαI    T/CGA CutSmart® Buffer 50 75 100 100 80°C 65°C B λ DNA
TfiI     G/AWTC CutSmart® Buffer 50 100 100 100 No 65°C C Blocked by Some Combinations of Overlapping λ DNA
TseI    G/CWGC CutSmart® Buffer 75 100 100 100 No 65°C B Blocked by Some Combinations of Overlapping λ DNA 3
Tsp45I /GTSAC CutSmart® Buffer 100 50 10 100 No 65°C A not sensitive λ DNA
TspMI    C/CCGGG CutSmart® Buffer 50* 75* 50* 100 No 75°C B blocked pUCAdeno plasmid DNA d
TspRI    NNCASTGNN/ CutSmart® Buffer 25 50 25 100 No 65°C B not sensitive λ DNA
Tth111I    GACN/NNGTC CutSmart® Buffer 25 100 25 100 No 65°C B not sensitive pBC4 DNA b
XbaI     T/CTAGA CutSmart® Buffer 10 100 75 100 65°C 37°C A not sensitive λ DNA (dam-/Hind III digest)
XcmI   CCANNNNN/NNNNTGG NEBuffer™ 2.1 10 100 25 100 65°C 37°C C not sensitive λ DNA 2
XhoI     C/TCGAG CutSmart® Buffer 75 100 100 100 65°C 37°C A Impaired λ DNA (HindIII digest) b
XmaI     C/CCGGG CutSmart® Buffer 25 50 10 100 65°C 37°C A Impaired Adenovirus-2 DNA 3
XmnI    GAANN/NNTTC CutSmart® Buffer 50 75 10 100 65°C 37°C A not sensitive λ DNA b
ZraI    GAC/GTC CutSmart® Buffer 100 25 10 100 80°C 37°C B blocked λ DNA

§ An HF version of this enzyme is available.
The values listed in this table are approximate. They were obtained using each enzyme's specific unit assay substrate DNA. 

Ligation and Recutting Notes
a. Ligation is less than 10%.
b. Ligation is 25% -75%.
c. Recutting after ligation is less than 5%.
d. Recutting after ligation is 50% -75%.
e. Ligation and recutting after ligation is not applicable since the enzyme is either a nicking enzyme, is affected by methylation, or the recognition sequence contains variable sequences.

Star Activity Notes
1. Star Activity may result from extended digestion, high enzyme concentration or a glycerol concentration of > 5%.
2. Star Activity may result from extended digestion.
3. Star Activity may result from a glycerol concentration of > 5%.
*. May exhibit star activity in this buffer.

Loading Spinner