• My NEB
  • Print
  • PDF
  • Nucleosome Control DNA

    Description

    Lytechinus variegatus 5SrDNA (1) of 208 bp is used for mononucleosome formation in a gel shift assay.

    Source

    Plasmid (Litmus 29) containing five copies 5SrDNA is isolated from E. coli NEB 10-beta by a standard purification procedure, digested and 208 bp DNA purified.

    Sequence

    ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAAT
    AGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACC
    GGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTG
    GATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA

    Advantages and Features

    Applications

    • A positive control for EpiMark Nucleosome Assembly Kit.

    Properties and Usage

    Storage Temperature

    -20°C

    Storage Conditions

    10 mM Tris-HCl
    1 mM EDTA
    pH 8.0 @ 25°C

    Suggested Working Concentration

    10μM

    Quality Control

    Quality Assurance Statement

    • Purified free of contaminating proteins and RNA.

    Notes

    1. A260/A280: > 1.80

    References

    1. Lu, A-Lien et al. (1980). Nucleic Acids Res.. 8, 1839-1853.

    Supporting Documents

    Material Safety Datasheets

    The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.