Nucleosome Control DNA

Description

Lytechinus variegatus 5SrDNA (1) of 208 bp is used for mononucleosome formation in a gel shift assay.

Source

Plasmid (Litmus 29) containing five copies 5SrDNA is isolated from E. coli NEB 10-beta by a standard purification procedure, digested and 208 bp DNA purified.

Sequence

ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAAT
AGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACC
GGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTG
GATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA

Advantages and Features

Applications

  • A positive control for EpiMark Nucleosome Assembly Kit.

Properties and Usage

Storage Temperature

-20°C

Storage Conditions

10 mM Tris-HCl
1 mM EDTA
pH 8.0 @ 25°C

Suggested Working Concentration

10μM

Notes

  1. A260/A280: > 1.80

References

  1. Lu, A-Lien et al. (1980). Nucleic Acids Res.. 8, 1839-1853.

Datacards

The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.

Interactive Tools

Quality Control

Quality Assurance Statement

  • Purified free of contaminating proteins and RNA.

Safety Data Sheet

The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

Datacards

The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.