Catalog # E3317 was discontinued on December 18, 2023
The EpiMark® 5-hmC and 5-mC Analysis Kit can be used to analyze and quantitate 5-methylcytosine and 5-hydroxymethylcytosine within a specific locus. Complete conversion of 5-hmC to glucosylated 5-hmC in DNA by T4 β-glucosyltransferase (T4-BGT).
Discrimination between 5-mC and 5-hmC in CCGG sequences using enzymatic digestion and PCR amplification
Relative quantitation of 5-mC and 5-hmC
Easy-to-use protocol
This kit contains enough material for 20 reactions
Product Information
5-methylcytosine (5-mC) is the predominant epigenetic mark in mammalian genomic DNA. 5-hydroxymethylcytosine (5-hmC) is a newly discoveredepigenetic modification that is presumably generated by oxidation of 5-mC by the TET family of cytosine oxygenases.1,2
Techniques exist that can identify 5-mC in genomic DNA, but the most commonly used method, bisulfite sequencing, is laborious and cannot distinguish between 5-mC from 5-hmC.3
The kit distinguishes 5-mC from 5-hmC by the addition of glucose to the hydroxyl group of 5-hmC via an enzymatic reaction utilizing T4 β-glucosyltransferase (T4-BGT). When 5-hmC occurs in the context of CCGG, this modification converts a cleavable MspI site to a noncleavable one.
An overview of the detection procedure is summarized in Figure 1.
Control DNA Sequence
5´-CAGTGAAGTTGGCAGACTGAGCCAGGTCCCACAGATGCAGTGACCGGAGT
CATTGCCAAACTCTGCAGGAGAGCAAGGGCTGTCTATAGGTGGCAAGTCA-3´
Control DNA substrates are synthetic 100 bp double stranded fragments containing a single MspI/HpaII site (CCGG). The three fragments are identical except for modification of the internal C in this site.
FW Primer Sequence
5´- CA GTG AAG TTG GCA GAC TGA GC -3´
REV Primer Sequence
5´- CTG ACT TGC CAC CTA TAG ACA GC -3´
This product is related to the following categories:
0.2 ml strip tubes and caps for PCR 1.5 ml reaction tubes Molecular biology grade water
Method Overview
Method Overview
Step I: DNA Glucosylation Reaction with T4 β-glucosyltransferase (T4-BGT) Genomic DNA of interest is treated with T4-BGT, adding a glucose moeity to 5-hydroxymethylcytosine. This reaction is sequence-independent - therefore all 5-hmC will be glucosylated, unmodified or 5-mC containing DNA will not be affected.
Step II: Restriction Endonuclease DigestionMspI and HpaII recognize the same sequence (CCGG) but are sensitive to different methylation status. HpaII cleaves only a completely unmodified site: any modification (5-mC, 5-hmC or 5-ghmC) at either cytosine blocks cleavage. MspI will recognize and cleave 5-mC and 5-hmC, but not 5-ghmC.
Step III: Interrogation of the Locus by PCR as little as 20 ng of input DNA can be used. Amplification of the experimental (glucosylated and digested) and control (mock glucosylated and digested) target DNA with primers flanking a CCGG site of interest (100–200 bp) is performed. If the CpG site contains 5-hydroxymethylcytosine, a band is detected after glucosylation and digestion, but not in the non-glucosylated control reaction (see Figure 2). Real time PCR will give an approximation of how much hydroxymethylcytosine is in this particular site.
Figure 1a: Experimental Overview The DNA of interest is treated with T4 β-Glucosyltransferase (T4-BGT) and UDP-Glucose (UDP-Glc). T4-BGT transfers glucose from UDP-Glc onto 5-hydroxymethylcytosine (generating glucosylated 5-hydroxymethylcytosine [5-ghmC]). MspI cuts DNA containing 5-hmC, but does not cut 5-ghmC containing sites; in contrast, HpaII is blocked by any of these modifications. Presence of 5-hmC and 5-mC can be determined by PCR analysis.Figure 1b: Experimental Overview The DNA of interest is digested following a control reaction with UDP-Glucose (UDP-Glc) and no T4 β-Glucosyltransferase (T4-BGT), leaving 5-hmC unmodified. MspI cleaves unmodified, 5-mC and 5-hmC DNA, while HpaII cleaves only unmodified DNA.Figure 2: Comparison of 5-hydroxymethylcytosine amounts at locus 12 in different mouse Balb/C tissue samples. (A) End-point PCR. (B) Real time PCR. DNA from four mouse tissues was analyzed. For comparative purposes, real time PCR data were normalized to uncut DNA. A standard curve was used to determine copy number. The samples could be normalized by dividing the copy number of samples No 1-6 by the copy number of the control that is undigested (No 5). Boxed gel lane shows variation in 5-hmC present.Figure 3: High sensitivity 5-hydroxymethylcytosine detection achieved by the EpiMark kit. 100 bp unmodified, 5-mC, and 5-hmC control DNAs were mixed in different ratios (blue bars), and then measured with the EpiMark hydroxymethylated DNA detection kit (orange bars). Error bars represent the standard deviation of four independent experiments.
Kienhöfer S., Musheev M., Stapf U., Helm M., Schomacher L., Niehrs C., Schäfer A. (2015) GADD45a physically and functionally interacts with TET1Publication Differentiation; PubMedID: 26546041, DOI: 10.1016/j.diff.2015.10.003
Zhao C, Wang H, Zhao B, Li C, Yin R, Song M, Liu B, Liu Z, Jiang G (2014) Boronic acid-mediated polymerase chain reaction for gene- and fragment-specific detection of 5-hydroxymethylcytosine Nucleic Acids Res; 42(9), e81. PubMedID: 24682822, DOI: 10.1093/nar/gku216
Chandra S, Baribault C, Lacey M, Ehrlich M (2014) Myogenic differential methylation: diverse associations with chromatin structure Biology (Basel); 3(2), 426-51. PubMedID: 24949935, DOI: 10.3390/biology3020426
Quality, Safety & Legal
Quality Control Assays
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.
Specifications & Change Notifications
The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]
The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]
Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.
This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.
New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.
Licenses
The purchase of this product conveys to the user the non-transferable right to use the purchased amount of product for Research Use Only. Commercial use of this product may require a license from New England Biolabs. Please contact busdev@neb.com for further details.
Based on your Freezer Program type, you are trying to add a product to your cart that is either not allowed or not allowed with the existing contents of your cart. Please review and update your order accordingly. If you have any questions, please contact Customer Support at freezers@neb.com or 1-800-632-5227 x 8.
You have been idle for more than 20 minutes, for your security you have been logged out. Please sign back in to continue your session.
Institution Changed
Your profile has been mapped to an Institution, please sign back for your profile updates to be completed.
Sign in to your NEB account
To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.
Powered by Bioz
