New England Biolabs

Isoschizomers

  • My NEB
  • Print
  • PDF
  • Restriction endonucleases that recognize the same sequence are isoschizomers. The first example discovered is called a prototype and all subsequent enzymes that recognize the same sequence are isoschizomers of the prototype. The list below contains isoschizomers for commercially available restriction endonucleases. It also specifies which isoschizomer is available from New England Biolabs.

    All recognition sequences are written 5´ to 3´ using the single letter code nomenclature with the point of cleavage indicated by a "/".

    Numbers in parentheses indicate point of cleavage for non-palindromic enzymes. For example, GGTCTC(1/5) indicates cleavage at:
    5´ ...GGTCTCN/...3´
    3´ ...CCAGAGNNNNN/...5´

    Isoschizomers with alternative cleavage sites are indicated with a " ^ ". Enzymes that are not currently commercially available are indicated with a " x ".

    Neoschizomers are a subset of isoschizomers that recognize the same sequence, but cleave at different positions from the prototype. Thus, AatII (recognition sequence: GACGT↓C) and ZraI (recognition sequence: GAC↓GTC) are neoschizomers of one another, while HpaII (recognition sequence: C↓CGG) and MspI (recognition sequence: C↓CGG) are isoschizomers. Analogous designations are not appropriate for MTases, where the differences between enzymes are not so easily defined and usually have not been well characterized.

    EnzymeSequenceNEB EnzymeCatalog NumberCut SiteOther Isoschizomers
    AanI TTA/TAAPsiIR0657TTA/TAAPsiI
    AarI CACCTGC(4/8)
    AasI GACNNNN/NNGTCDrdIR0530GACNNNN/NNGTCDrdI, DseDI
    AatI AGG/CCTStuIR0187AGG/CCTEco147I, PceI , SseBI, StuI
    AatIIGACGT/CAatIIR0117GACGT/CZraI^
    ZraI^R0659GAC/GTC
    AauI T/GTACABsrGIR0575T/GTACABsp1407I, BsrGI, BstAUI, SspBI
    AbsI CC/TCGAGG
    Acc113I AGT/ACTScaIR0122AGT/ACTAssI , BmcAI^, ScaI, ZrmI
    Acc16I TGC/GCAFspIR0135TGC/GCAAviII , FspI, MstI, NsbI
    Acc36I ACCTGC(4/8)BfuAIR0701ACCTGC(4/8)BfuAI, BspMI, BveI
    BspMIR0502ACCTGC(4/8)
    Acc65IG/GTACCAcc65IR0599G/GTACCAsp718I , KpnI^
    KpnI^R0142GGTAC/C
    AccB1I G/GYRCCBanIR0118G/GYRCCBanI, BshNI, BspT107I, HgiCI
    AccB7I CCANNNN/NTGGPflMIR0509CCANNNN/NTGGBasI , PflBI , PflMI, Van91I
    AccBSI CCGCTC(-3/-3)BsrBIR0102CCGCTC(-3/-3)BsrBI, MbiI
    AccIGT/MKACAccIR0161GT/MKACFblI, XmiI
    AccII CG/CGBstUIR0518CG/CGBsh1236I, BspFNI^, BstFNI, BstUI, FnuDII^, MvnI, ThaI
    AccIIIT/CCGGABspEIR0540T/CCGGAAor13HI , BlfI , BseAI, BsiMI, Bsp13I, BspEI, BspMII, Kpn2I , MroI
    AceIII xCAGCTC(7/11)
    AciICCGC(-3/-1)AciIR0551CCGC(-3/-1)BspACI, SsiI
    AclIAA/CGTTAclIR0598AA/CGTTPsp1406I
    AclWI GGATC(4/5)AlwIR0513GGATC(4/5)AlwI, BinI, BspPI, Nt.AlwI^
    Nt.AlwI^R0627GGATC(4/-5)
    AcoI Y/GGCCREaeIR0508Y/GGCCRCfrI, EaeI
    AcsI R/AATTYApoIR0566R/AATTYApoI, XapI
    AcuICTGAAG(16/14)AcuIR0641CTGAAG(16/14)Eco57I
    AcvI CAC/GTGPmlIR0532CAC/GTGBbrPI , Eco72I, PmaCI , PmlI, PspCI
    AcyI GR/CGYCBsaHIR0556GR/CGYCBsaHI, BssNI, BstACI, Hin1I, Hsp92I
    AdeI CACNNN/GTGDraIIIR0510CACNNN/GTGDraIII
    AfaI GT/ACCviQI^R0639G/TACCsp6I^, CviQI^, RsaI
    RsaIR0167GT/AC
    AfeIAGC/GCTAfeIR0652AGC/GCTAor51HI , Eco47III, FunI
    AfiI CCNNNNN/NNGGBslIR0555CCNNNNN/NNGGBsc4I, BseLI, BsiYI, BslI
    AflI G/GWCCAvaIIR0153G/GWCCAvaII, Bme18I, Eco47I, PspO3I^, SinI, Vpak11AI^
    AflIIC/TTAAGAflIIR0520C/TTAAGBfrI , BspTI, Bst98I, BstAFI, MspCI, Vha464I
    AflIIIA/CRYGTAflIIIR0541A/CRYGT
    AgeIA/CCGGTAgeIR0552A/CCGGTAsiAI , BshTI, CspAI, PinAI
    AgsITTS/AA
    AhaIII xTTT/AAADraI^R0129TTT/AAADraI^
    AhdIGACNNN/NNGTCAhdIR0584GACNNN/NNGTCAspEI , BmeRI, DriI, Eam1105I, EclHKI, NruGI
    AhlI A/CTAGTSpeIR0133A/CTAGTBcuI , SpeI
    AjiI CACGTC(-3/-3)BmgBIR0628CACGTC(-3/-3)BmgBI, BtrI^
    AjnI /CCWGGBstNI^R0168CC/WGGBciT130I^, BptI^, BseBI^, BsiLI^, Bst2UI^, BstNI^, BstOI^, EcoRII^, MvaI^, Psp6I ^, PspGI^
    PspGI^R0611/CCWGG
    AjuI (7/12)GAANNNNNNNTTGG(11/6)
    AleICACNN/NNGTGAleIR0634CACNN/NNGTGOliI
    AlfI(10/12)GCANNNNNNTGC(12/10)
    AloI (7/12)GAACNNNNNNTCC(12/7)
    AluBI AG/CT
    AluIAG/CTAluIR0137AG/CT
    Alw21I GWGCW/CBsiHKAIR0570GWGCW/CAspHI , Bbv12I , BsiHKAI, HgiAI
    Alw26I GTCTC(1/5)BcoDIR0542GTCTC(1/5)BcoDI, BsmAI, BsoMAI, BstMAI, Nt.BsmAI^
    BsmAIR0529GTCTC(1/5)
    Nt.BsmAI^R0121GTCTC(1/-5)
    Alw44I G/TGCACApaLIR0507G/TGCACApaLI, VneI
    AlwFI xGAAAYNNNNNRTG
    AlwIGGATC(4/5)AlwIR0513GGATC(4/5)AclWI , BinI, BspPI, Nt.AlwI^
    Nt.AlwI^R0627GGATC(4/-5)
    AlwNICAGNNN/CTGAlwNIR0514CAGNNN/CTGCaiI, PstNI
    Ama87I C/YCGRGAvaIR0152C/YCGRGAvaI, BcoI , BmeT110I, BsiHKCI, BsoBI, Eco88I, NspIII
    BsoBIR0586C/YCGRG
    AocI CC/TNAGGBsu36IR0524CC/TNAGGAxyI , Bse21I, Bsu36I, CvnI, Eco81I, SauI
    Aor13HI T/CCGGABspEIR0540T/CCGGAAccIII, BlfI , BseAI, BsiMI, Bsp13I, BspEI, BspMII, Kpn2I , MroI
    Aor51HI AGC/GCTAfeIR0652AGC/GCTAfeI, Eco47III, FunI
    AoxIx/GGCCHaeIII^R0108GG/CCBshFI ^, BsnI^, BspANI^, BsuRI^, HaeIII^, PalI ^, PhoI^
    PhoI^R0705GG/CC
    ApaBIxGCANNNNN/TGCBstAPI^R0654GCANNNN/NTGCBstAPI^
    ApaIGGGCC/CApaIR0114GGGCC/CBsp120I^, PspOMI^
    PspOMI^R0653G/GGCCC
    ApaLIG/TGCACApaLIR0507G/TGCACAlw44I , VneI
    ApeKIG/CWGCApeKIR0643G/CWGCTseI
    TseIR0591G/CWGC
    ApoIR/AATTYApoIR0566R/AATTYAcsI , XapI
    ApyPIxATCGAC(20/18)
    AquIIxGCCGNAC(20/18)
    AquIVxGRGGAAG(19/17)
    ArsI(8/13)GACNNNNNNTTYG(11/6)
    AscIGG/CGCGCCAscIR0558GG/CGCGCCPalAI , SgsI
    AseIAT/TAATAseIR0526AT/TAATAsnI , PshBI , VspI
    AsiAI A/CCGGTAgeIR0552A/CCGGTAgeI, BshTI, CspAI, PinAI
    AsiGI A/CCGGTAgeIR0552A/CCGGTAgeI, AsiAI , BshTI, CspAI, PinAI
    AsiSIGCGAT/CGCAsiSIR0630GCGAT/CGCRgaI, SfaAI, SgfI
    AsnI AT/TAATAseIR0526AT/TAATAseI, PshBI , VspI
    Asp700I GAANN/NNTTCXmnIR0194GAANN/NNTTCMroXI, PdmI , XmnI
    Asp718I G/GTACCAcc65IR0599G/GTACCAcc65I, KpnI^
    KpnI^R0142GGTAC/C
    AspA2I C/CTAGGAvrIIR0174C/CTAGGAvrII, BlnI , BspA2I, XmaJI
    AspBHIxYSCNS(8/12)
    AspCNI xGCCGC
    AspEI GACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, BmeRI, DriI, Eam1105I, EclHKI, NruGI
    AspHI GWGCW/CBsiHKAIR0570GWGCW/CAlw21I , Bbv12I , BsiHKAI, HgiAI
    AspI GACN/NNGTCPflFIR0595GACN/NNGTCPflFI, PsyI, TelI, Tth111I
    Tth111IR0185GACN/NNGTC
    AspLEI GCG/CHhaIR0139GCG/CBstHHI, CfoI, GlaI^, HhaI, R9529^, HinP1I^, HspAI ^
    HinP1I^R0124G/CGC
    AspS9I G/GNCCSau96IR0165G/GNCCAsuI , BmgT120I^, BsiZI, BspLI^, Cfr13I, FmuI^, PspPI , Sau96I, UnbI^
    AssI AGT/ACTScaIR0122AGT/ACTAcc113I , BmcAI^, ScaI, ZrmI
    AsuC2I CC/SGGNciIR0196CC/SGGBcnI , BpuMI, CauII, EcoHI^, NciI
    AsuHPI GGTGA(8/7)HphIR0158GGTGA(8/7)HphI
    AsuI xG/GNCCSau96IR0165G/GNCCAspS9I , BmgT120I^, BsiZI, BspLI^, Cfr13I, FmuI^, PspPI , Sau96I, UnbI^
    AsuII TT/CGAABstBIR0519TT/CGAABpu14I, BsiCI, Bsp119I, BspT104I, BstBI, Csp45I, NspV , SfuI
    AsuNHI G/CTAGCBmtI^R0658GCTAG/CBmtI^, BspOI^, NheI
    NheIR0131G/CTAGC
    AvaIC/YCGRGAvaIR0152C/YCGRGAma87I , BcoI , BmeT110I, BsiHKCI, BsoBI, Eco88I, NspIII
    BsoBIR0586C/YCGRG
    AvaIIG/GWCCAvaIIR0153G/GWCCAflI , Bme18I, Eco47I, PspO3I^, SinI, Vpak11AI^
    AvaIII xATGCATNsiI^R0127ATGCA/TBfrBl^, EcoT22I^, Mph1103I^, NsiI^, Zsp2I^
    AviII TGC/GCAFspIR0135TGC/GCAAcc16I , FspI, MstI, NsbI
    AvrIIC/CTAGGAvrIIR0174C/CTAGGAspA2I , BlnI , BspA2I, XmaJI
    AxyI CC/TNAGGBsu36IR0524CC/TNAGGAocI , Bse21I, Bsu36I, CvnI, Eco81I, SauI
    BaeGIGKGCM/CBaeGIR0708GKGCM/CBseSI, BstSLI
    BaeI(10/15)ACNNNNGTAYC(12/7)BaeIR0613(10/15)ACNNNNGTAYC(12/7)
    BalI TGG/CCAMscIR0534TGG/CCAMlsI, MluNI, MscI, Msp20I
    BamHIG/GATCCBamHIR0136G/GATCC
    BanIG/GYRCCBanIR0118G/GYRCCAccB1I , BshNI, BspT107I, HgiCI
    BanIIGRGCY/CBanIIR0119GRGCY/CEco24I, EcoT38I, FriOI, HgiJII
    BanIII AT/CGATBspDIR0557AT/CGATBsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
    ClaIR0197AT/CGAT
    BarI (7/12)GAAGNNNNNNTAC(12/7)
    BasI CCANNNN/NTGGPflMIR0509CCANNNN/NTGGAccB7I , PflBI , PflMI, Van91I
    BauI CACGAG(-5/-1)BssSIR0587CACGAG(-5/-1)BsiI, BssSI, Bst2BI
    BbeI GGCGC/CKasI^R0544G/GCGCCDinI^, EgeI^, KasI^, Mly113I^, NarI^, PluTI, SfoI^, SspDI^
    NarI^R0191GG/CGCC
    PluTIR0713GGCGC/C
    SfoI^R0606GGC/GCC
    BbrPI CAC/GTGPmlIR0532CAC/GTGAcvI , Eco72I, PmaCI , PmlI, PspCI
    BbsIGAAGAC(2/6)BbsIR0539GAAGAC(2/6)BbvII , BpiI, BpuAI, BstV2I
    BbuI GCATG/CSphI-HF™R3182GCATG/CPaeI , SpaHI, SphI-HF™
    Bbv12I GWGCW/CBsiHKAIR0570GWGCW/CAlw21I , AspHI , BsiHKAI, HgiAI
    BbvCICCTCAGC(-5/-2)BbvCIR0601CCTCAGC(-5/-2)Nb.BbvCI^, Nt.BbvCI^
    Nb.BbvCI^R0631CCTCAGC
    Nt.BbvCI^R0632CCTCAGC(-5/-7)
    BbvIGCAGC(8/12)BbvIR0173GCAGC(8/12)BseXI, Bst71I, BstV1I, R9896
    BbvII xGAAGAC(2/6)BbsIR0539GAAGAC(2/6)BbsI, BpiI, BpuAI, BstV2I
    BccICCATC(4/5)BccIR0704CCATC(4/5)
    Bce83I xCTTGAG(16/14)BpuEIR0633CTTGAG(16/14)BpuEI
    BceAIACGGC(12/14)BceAIR0623ACGGC(12/14)
    BcefI xACGGC(12/13)
    BcgI(10/12)CGANNNNNNTGC(12/10)BcgIR0545(10/12)CGANNNNNNTGC(12/10)
    BciT130ICC/WGGBstNIR0168CC/WGGAjnI ^, BptI, BseBI, BsiLI, Bst2UI, BstNI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
    PspGI^R0611/CCWGG
    BciVIGTATCC(6/5)BciVIR0596GTATCC(6/5)BfuI , BsuI
    BclIT/GATCABclIR0160T/GATCABsiQI, FbaI, Ksp22I
    BcnI CC/SGGNciIR0196CC/SGGAsuC2I , BpuMI, CauII, EcoHI^, NciI
    BcoDIGTCTC(1/5)BcoDIR0542GTCTC(1/5)Alw26I , BsmAI, BsoMAI, BstMAI, Nt.BsmAI^
    BsmAIR0529GTCTC(1/5)
    Nt.BsmAI^R0121GTCTC(1/-5)
    BcoI C/YCGRGAvaIR0152C/YCGRGAma87I , AvaI, BmeT110I, BsiHKCI, BsoBI, Eco88I, NspIII
    BsoBIR0586C/YCGRG
    BcuI A/CTAGTSpeIR0133A/CTAGTAhlI , SpeI
    BdaI(10/12)TGANNNNNNTCA(12/10)
    BetI xW/CCGGWBsaWIR0567W/CCGGWBsaWI
    BfaIC/TAGBfaIR0568C/TAGFspBI, MaeI, XspI
    BfiI ACTGGG(5/4)BmrIR0600ACTGGG(5/4)BmrI, BmuI
    BfmI C/TRYAGSfcIR0561C/TRYAGBpcI, BstSFI, SfcI
    BfoIRGCGC/YHaeIIR0107RGCGC/YBsp143II, BstH2I, HaeII
    BfrBlxATGCA/TNsiIR0127ATGCA/TAvaIII ^, EcoT22I, Mph1103I, NsiI, Zsp2I
    BfrI C/TTAAGAflIIR0520C/TTAAGAflII, BspTI, Bst98I, BstAFI, MspCI, Vha464I
    BfuAIACCTGC(4/8)BfuAIR0701ACCTGC(4/8)Acc36I , BspMI, BveI
    BspMIR0502ACCTGC(4/8)
    BfuCI/GATCBfuCIR0636/GATCBscFI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
    DpnI^R0176GA/TC
    MboIR0147/GATC
    Sau3AIR0169/GATC
    BfuI GTATCC(6/5)BciVIR0596GTATCC(6/5)BciVI, BsuI
    BglIGCCNNNN/NGGCBglIR0143GCCNNNN/NGGC
    BglIIA/GATCTBglIIR0144A/GATCT
    BinIxGGATC(4/5)AlwIR0513GGATC(4/5)AclWI , AlwI, BspPI, Nt.AlwI^
    Nt.AlwI^R0627GGATC(4/-5)
    BisI GC/NGCFnu4HIR0178GC/NGCBlsI ^, BthCI^, Fnu4HI, Fsp4HI, GluI, ItaI , SatI
    BlfI T/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BseAI, BsiMI, Bsp13I, BspEI, BspMII, Kpn2I , MroI
    BlnI C/CTAGGAvrIIR0174C/CTAGGAspA2I , AvrII, BspA2I, XmaJI
    BlpIGC/TNAGCBlpIR0585GC/TNAGCBpu1102I, Bsp1720I, CelII, EspI
    BlsI GCN/GCFnu4HI^R0178GC/NGCBisI ^, BthCI^, Fnu4HI^, Fsp4HI^, GluI^, ItaI ^, SatI^
    BmcAIAGT/ACTScaI^R0122AGT/ACTAcc113I ^, AssI ^, ScaI^, ZrmI^
    Bme1390ICC/NGGBssKI^R0592/CCNGGBmrFI, BssKI^, BstSCI^, MspR9I, ScrFI, StyD4I^
    ScrFIR0110CC/NGG
    StyD4I^R0638/CCNGG
    Bme18IG/GWCCAvaIIR0153G/GWCCAflI , AvaII, Eco47I, PspO3I^, SinI, Vpak11AI^
    BmeRIGACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, AspEI , DriI, Eam1105I, EclHKI, NruGI
    BmeT110IC/YCGRGAvaIR0152C/YCGRGAma87I , AvaI, BcoI , BsiHKCI, BsoBI, Eco88I, NspIII
    BsoBIR0586C/YCGRG
    BmgBICACGTC(-3/-3)BmgBIR0628CACGTC(-3/-3)AjiI , BtrI^
    BmgIxGKGCCC
    BmgT120IGG/NCCSau96I^R0165G/GNCCAspS9I ^, AsuI ^, BsiZI^, BspLI^, Cfr13I^, FmuI^, PspPI ^, Sau96I^, UnbI^
    BmiIGGN/NCCNlaIVR0126GGN/NCCBscBI, NlaIV, PspN4I
    BmrFICC/NGGBssKI^R0592/CCNGGBme1390I, BssKI^, BstSCI^, MspR9I, ScrFI, StyD4I^
    ScrFIR0110CC/NGG
    StyD4I^R0638/CCNGG
    BmrIACTGGG(5/4)BmrIR0600ACTGGG(5/4)BfiI , BmuI
    BmsIGCATC(5/9)SfaNIR0172GCATC(5/9)LweI, SfaNI
    BmtIGCTAG/CBmtIR0658GCTAG/CAsuNHI ^, BspOI, NheI^
    NheI^R0131G/CTAGC
    BmuIACTGGG(5/4)BmrIR0600ACTGGG(5/4)BfiI , BmrI
    BmyIGDGCH/CBsp1286IR0120GDGCH/CBsp1286I, MhlI, SduI
    BoxIGACNN/NNGTCPshAIR0593GACNN/NNGTCBstPAI, PshAI
    BpcIC/TRYAGSfcIR0561C/TRYAGBfmI , BstSFI, SfcI
    BpiIGAAGAC(2/6)BbsIR0539GAAGAC(2/6)BbsI, BbvII , BpuAI, BstV2I
    BplI(8/13)GAGNNNNNCTC(13/8)
    BpmICTGGAG(16/14)BpmIR0565CTGGAG(16/14)GsuI
    BptICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BseBI, BsiLI, Bst2UI, BstNI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
    PspGI^R0611/CCWGG
    Bpu10ICCTNAGC(-5/-2)Bpu10IR0649CCTNAGC(-5/-2)
    Bpu1102IGC/TNAGCBlpIR0585GC/TNAGCBlpI, Bsp1720I, CelII, EspI
    Bpu14ITT/CGAABstBIR0519TT/CGAAAsuII , BsiCI, Bsp119I, BspT104I, BstBI, Csp45I, NspV , SfuI
    BpuAIGAAGAC(2/6)BbsIR0539GAAGAC(2/6)BbsI, BbvII , BpiI, BstV2I
    BpuEICTTGAG(16/14)BpuEIR0633CTTGAG(16/14)Bce83I
    BpuMICC/SGGNciIR0196CC/SGGAsuC2I , BcnI , CauII, EcoHI^, NciI
    BpvUICGAT/CGPvuIR0150CGAT/CGBspCI, MvrI, Ple19I , PvuI
    Bsa29IAT/CGATBspDIR0557AT/CGATBanIII , BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
    ClaIR0197AT/CGAT
    BsaAIYAC/GTRBsaAIR0531YAC/GTRBstBAI, Ppu21I
    BsaBIGATNN/NNATCBsaBIR0537GATNN/NNATCBse8I, BseJI, BsiBI, BsrBRI, MamI
    BsaHIGR/CGYCBsaHIR0556GR/CGYCAcyI , BssNI, BstACI, Hin1I, Hsp92I
    BsaIGGTCTC(1/5)BsaIR0535GGTCTC(1/5)Bso31I, BspTNI, Eco31I
    BsaJIC/CNNGGBsaJIR0536C/CNNGGBseDI, BssECI, SecI
    BsaMIGAATGC(1/-1)BsmIR0134GAATGC(1/-1)BscCI, BsmI, Mva1269I, Nb.BsmI^, PctI
    Nb.BsmI^R0706GAATGC
    BsaOICGRY/CGBsiEIR0554CGRY/CGBsh1285I , BsiEI, BstMCI, McrI
    BsaWIW/CCGGWBsaWIR0567W/CCGGWBetI
    BsaXI(9/12)ACNNNNNCTCC(10/7)BsaXIR0609(9/12)ACNNNNNCTCC(10/7)
    BsbIxCAACAC(21/19)
    Bsc4ICCNNNNN/NNGGBslIR0555CCNNNNN/NNGGAfiI , BseLI, BsiYI, BslI
    BscBIGGN/NCCNlaIVR0126GGN/NCCBmiI, NlaIV, PspN4I
    BscCIGAATGC(1/-1)BsmIR0134GAATGC(1/-1)BsaMI, BsmI, Mva1269I, Nb.BsmI^, PctI
    Nb.BsmI^R0706GAATGC
    BscFI/GATCBfuCIR0636/GATCBfuCI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
    DpnI^R0176GA/TC
    MboIR0147/GATC
    Sau3AIR0169/GATC
    BscGIxCCCGT
    Bse118IR/CCGGYBsrFIR0562R/CCGGYBsrFI, BssAI, Cfr10I
    Bse1IACTGG(1/-1)BsrIR0527ACTGG(1/-1)BseNI, BsrI
    Bse21ICC/TNAGGBsu36IR0524CC/TNAGGAocI , AxyI , Bsu36I, CvnI, Eco81I, SauI
    Bse3DIGCAATG(2/0)BsrDIR0574GCAATG(2/0)BseMI, BsrDI, Nb.BsrDI^
    Nb.BsrDI^R0648GCAATG
    Bse8IGATNN/NNATCBsaBIR0537GATNN/NNATCBsaBI, BseJI, BsiBI, BsrBRI, MamI
    BseAIT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BsiMI, Bsp13I, BspEI, BspMII, Kpn2I , MroI
    BseBICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BsiLI, Bst2UI, BstNI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
    PspGI^R0611/CCWGG
    BseCIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
    ClaIR0197AT/CGAT
    BseDIC/CNNGGBsaJIR0536C/CNNGGBsaJI, BssECI, SecI
    BseGIGGATG(2/0)BtsCIR0647GGATG(2/0)BstF5I, BtsCI, FokI^
    FokI^R0109GGATG(9/13)
    BseJIGATNN/NNATCBsaBIR0537GATNN/NNATCBsaBI, Bse8I, BsiBI, BsrBRI, MamI
    BseLICCNNNNN/NNGGBslIR0555CCNNNNN/NNGGAfiI , Bsc4I, BsiYI, BslI
    BseMIGCAATG(2/0)BsrDIR0574GCAATG(2/0)Bse3DI, BsrDI, Nb.BsrDI^
    Nb.BsrDI^R0648GCAATG
    BseMIICTCAG(10/8)BspCNI^R0624CTCAG(9/7)BspCNI^
    BseNIACTGG(1/-1)BsrIR0527ACTGG(1/-1)Bse1I, BsrI
    BsePIG/CGCGCBssHIIR0199G/CGCGCBssHII, PauI , PteI
    BseRIGAGGAG(10/8)BseRIR0581GAGGAG(10/8)
    BseSIGKGCM/CBaeGIR0708GKGCM/CBaeGI, BstSLI
    BseX3I C/GGCCGEagIR0505C/GGCCGBstZI, EagI, EclXI, Eco52I, XmaIII
    BseXIGCAGC(8/12)BbvIR0173GCAGC(8/12)BbvI, Bst71I, BstV1I, R9896
    BseYICCCAGC(-5/-1)BseYIR0635CCCAGC(-5/-1)GsaI^
    BsgIGTGCAG(16/14)BsgIR0559GTGCAG(16/14)
    Bsh1236ICG/CGBstUIR0518CG/CGAccII , BspFNI^, BstFNI, BstUI, FnuDII^, MvnI, ThaI
    Bsh1285I CGRY/CGBsiEIR0554CGRY/CGBsaOI, BsiEI, BstMCI, McrI
    BshFI GG/CCHaeIIIR0108GG/CCAoxI^, BsnI, BspANI, BsuRI, HaeIII, PalI , PhoI
    PhoIR0705GG/CC
    BshI GG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BsnI, BspANI, BsuRI, HaeIII, PalI , PhoI
    PhoIR0705GG/CC
    BshNIG/GYRCCBanIR0118G/GYRCCAccB1I , BanI, BspT107I, HgiCI
    BshTIA/CCGGTAgeIR0552A/CCGGTAgeI, AsiAI , CspAI, PinAI
    BshVIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
    ClaIR0197AT/CGAT
    BsiBIGATNN/NNATCBsaBIR0537GATNN/NNATCBsaBI, Bse8I, BseJI, BsrBRI, MamI
    BsiCITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, Bsp119I, BspT104I, BstBI, Csp45I, NspV , SfuI
    BsiEICGRY/CGBsiEIR0554CGRY/CGBsaOI, Bsh1285I , BstMCI, McrI
    BsiHKAIGWGCW/CBsiHKAIR0570GWGCW/CAlw21I , AspHI , Bbv12I , HgiAI
    BsiHKCIC/YCGRGAvaIR0152C/YCGRGAma87I , AvaI, BcoI , BmeT110I, BsoBI, Eco88I, NspIII
    BsoBIR0586C/YCGRG
    BsiIxCACGAG(-5/-1)BssSIR0587CACGAG(-5/-1)BauI , BssSI, Bst2BI
    BsiLICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BseBI, Bst2UI, BstNI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
    PspGI^R0611/CCWGG
    BsiMIT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, Bsp13I, BspEI, BspMII, Kpn2I , MroI
    BsiQIT/GATCABclIR0160T/GATCABclI, FbaI, Ksp22I
    BsiSIC/CGGHpaIIR0171C/CGGHapII, HpaII, MspI
    MspIR0106C/CGG
    BsiWIC/GTACGBsiWIR0553C/GTACGPfl23II , PspLI , SplI, SunI
    BsiXIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
    ClaIR0197AT/CGAT
    BsiYIxCCNNNNN/NNGGBslIR0555CCNNNNN/NNGGAfiI , Bsc4I, BseLI, BslI
    BsiZIG/GNCCSau96IR0165G/GNCCAspS9I , AsuI , BmgT120I^, BspLI^, Cfr13I, FmuI^, PspPI , Sau96I, UnbI^
    BslFIGGGAC(10/14)BsmFIR0572GGGAC(10/14)BsmFI, FaqI, FinI^
    BslICCNNNNN/NNGGBslIR0555CCNNNNN/NNGGAfiI , Bsc4I, BseLI, BsiYI
    BsmAIGTCTC(1/5)BsmAIR0529GTCTC(1/5)Alw26I , BcoDI, BsoMAI, BstMAI, Nt.BsmAI^
    BcoDIR0542GTCTC(1/5)
    Nt.BsmAI^R0121GTCTC(1/-5)
    BsmBICGTCTC(1/5)BsmBIR0580CGTCTC(1/5)Esp3I
    BsmFIGGGAC(10/14)BsmFIR0572GGGAC(10/14)BslFI, FaqI, FinI^
    BsmIGAATGC(1/-1)BsmIR0134GAATGC(1/-1)BsaMI, BscCI, Mva1269I, Nb.BsmI^, PctI
    Nb.BsmI^R0706GAATGC
    BsnIGG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BspANI, BsuRI, HaeIII, PalI , PhoI
    PhoIR0705GG/CC
    Bso31IGGTCTC(1/5)BsaIR0535GGTCTC(1/5)BsaI, BspTNI, Eco31I
    BsoBIC/YCGRGBsoBIR0586C/YCGRGAma87I , AvaI, BcoI , BmeT110I, BsiHKCI, Eco88I, NspIII
    AvaIR0152C/YCGRG
    BsoMAIGTCTC(1/5)BcoDIR0542GTCTC(1/5)Alw26I , BcoDI, BsmAI, BstMAI, Nt.BsmAI^
    BsmAIR0529GTCTC(1/5)
    Nt.BsmAI^R0121GTCTC(1/-5)
    Bsp106IAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
    ClaIR0197AT/CGAT
    Bsp119ITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, BspT104I, BstBI, Csp45I, NspV , SfuI
    Bsp120IG/GGCCCApaI^R0114GGGCC/CApaI^, PspOMI
    PspOMIR0653G/GGCCC
    Bsp1286IGDGCH/CBsp1286IR0120GDGCH/CBmyI, MhlI, SduI
    Bsp13IT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, BsiMI, BspEI, BspMII, Kpn2I , MroI
    Bsp1407IT/GTACABsrGIR0575T/GTACAAauI , BsrGI, BstAUI, SspBI
    Bsp143I/GATCBfuCIR0636/GATCBfuCI, BscFI, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
    DpnI^R0176GA/TC
    MboIR0147/GATC
    Sau3AIR0169/GATC
    Bsp143IIRGCGC/YHaeIIR0107RGCGC/YBfoI, BstH2I, HaeII
    Bsp1720IGC/TNAGCBlpIR0585GC/TNAGCBlpI, Bpu1102I, CelII, EspI
    Bsp19IC/CATGGNcoIR0193C/CATGGNcoI
    Bsp24Ix(8/13)GACNNNNNNTGG(12/7)
    Bsp68ITCG/CGANruIR0192TCG/CGABtuMI, NruI, RruI^
    BspA2IC/CTAGGAvrIIR0174C/CTAGGAspA2I , AvrII, BlnI , XmaJI
    BspACICCGC(-3/-1)AciIR0551CCGC(-3/-1)AciI, SsiI
    BspANIGG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BsnI, BsuRI, HaeIII, PalI , PhoI
    PhoIR0705GG/CC
    BspCICGAT/CGPvuIR0150CGAT/CGBpvUI, MvrI, Ple19I , PvuI
    BspCNICTCAG(9/7)BspCNIR0624CTCAG(9/7)BseMII^
    BspDIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
    ClaIR0197AT/CGAT
    BspEIT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, BsiMI, Bsp13I, BspMII, Kpn2I , MroI
    BspFNICG/CGBstUI^R0518CG/CGAccII ^, Bsh1236I^, BstFNI^, BstUI^, FnuDII, MvnI^, ThaI^
    BspGIxCTGGAC
    BspHIT/CATGABspHIR0517T/CATGACciI, PagI , RcaI
    BspLIGGN/CCSau96I^R0165G/GNCCAspS9I ^, AsuI ^, BmgT120I^, BsiZI^, Cfr13I^, FmuI^, PspPI ^, Sau96I^, UnbI^
    BspLU11IxA/CATGTPciIR0655A/CATGTPciI, PscI
    BspMAI CTGCA/GPstIR0140CTGCA/GPstI
    BspMIACCTGC(4/8)BspMIR0502ACCTGC(4/8)Acc36I , BfuAI, BveI
    BfuAIR0701ACCTGC(4/8)
    BspMIIxT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, BsiMI, Bsp13I, BspEI, Kpn2I , MroI
    BspNCIxCCAGA
    BspOIGCTAG/CBmtIR0658GCTAG/CAsuNHI ^, BmtI, NheI^
    NheI^R0131G/CTAGC
    BspPIGGATC(4/5)AlwIR0513GGATC(4/5)AclWI , AlwI, BinI, Nt.AlwI^
    Nt.AlwI^R0627GGATC(4/-5)
    BspQIGCTCTTC(1/4)BspQIR0712GCTCTTC(1/4)LguI, Nt.BspQI^, PciSI , SapI
    Nt.BspQI^R0644GCTCTTC(1/-7)
    SapIR0569GCTCTTC(1/4)
    BspT104ITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, Bsp119I, BstBI, Csp45I, NspV , SfuI
    BspT107IG/GYRCCBanIR0118G/GYRCCAccB1I , BanI, BshNI, HgiCI
    BspTIC/TTAAGAflIIR0520C/TTAAGAflII, BfrI , Bst98I, BstAFI, MspCI, Vha464I
    BspTNIGGTCTC(1/5)BsaIR0535GGTCTC(1/5)BsaI, Bso31I, Eco31I
    BspUIxGCSG/C
    BspXIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, Bsu15I, BsuTUI, ClaI, ZhoI
    ClaIR0197AT/CGAT
    BsrBICCGCTC(-3/-3)BsrBIR0102CCGCTC(-3/-3)AccBSI , MbiI
    BsrBRIGATNN/NNATCBsaBIR0537GATNN/NNATCBsaBI, Bse8I, BseJI, BsiBI, MamI
    BsrDIGCAATG(2/0)BsrDIR0574GCAATG(2/0)Bse3DI, BseMI, Nb.BsrDI^
    Nb.BsrDI^R0648GCAATG
    BsrFIR/CCGGYBsrFIR0562R/CCGGYBse118I, BssAI, Cfr10I
    BsrGIT/GTACABsrGIR0575T/GTACAAauI , Bsp1407I, BstAUI, SspBI
    BsrIACTGG(1/-1)BsrIR0527ACTGG(1/-1)Bse1I, BseNI
    BsrSIACTGG(1/-1)BsrIR0527ACTGG(1/-1)Bse1I, BseNI, BsrI
    BssAIR/CCGGYBsrFIR0562R/CCGGYBse118I, BsrFI, Cfr10I
    BssECIC/CNNGGBsaJIR0536C/CNNGGBsaJI, BseDI, SecI
    BssHIC/TCGAGPaeR7IR0177C/TCGAGPaeR7I, Sfr274I, SlaI, StrI, TliI, XhoI
    TliIR0612C/TCGAG
    XhoIR0146C/TCGAG
    BssHIIG/CGCGCBssHIIR0199G/CGCGCBsePI, PauI , PteI
    BssKI/CCNGGBssKIR0592/CCNGGBme1390I^, BmrFI^, BstSCI, MspR9I^, ScrFI^, StyD4I
    ScrFI^R0110CC/NGG
    StyD4IR0638/CCNGG
    BssMI/GATCBfuCIR0636/GATCBfuCI, BscFI, Bsp143I, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
    DpnI^R0176GA/TC
    MboIR0147/GATC
    Sau3AIR0169/GATC
    BssNAIGTA/TACBstZ17IR0594GTA/TACBst1107I, BstZ17I, SnaI^
    BssNIGR/CGYCBsaHIR0556GR/CGYCAcyI , BsaHI, BstACI, Hin1I, Hsp92I
    BssSICACGAG(-5/-1)BssSIR0587CACGAG(-5/-1)BauI , BsiI, Bst2BI
    BssT1IC/CWWGGStyIR0500C/CWWGGEco130I, EcoT14I, ErhI , StyI
    Bst1107IGTA/TACBstZ17IR0594GTA/TACBssNAI, BstZ17I, SnaI^
    Bst2BICACGAG(-5/-1)BssSIR0587CACGAG(-5/-1)BauI , BsiI, BssSI
    Bst2UICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BseBI, BsiLI, BstNI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
    PspGI^R0611/CCWGG
    Bst4CIACN/GTHpyCH4IIIR0618ACN/GTHpyCH4III, TaaI, Tsp4CI
    Bst6ICTCTTC(1/4)EarIR0528CTCTTC(1/4)Eam1104I, EarI, Ksp632I
    Bst71IxGCAGC(8/12)BbvIR0173GCAGC(8/12)BbvI, BseXI, BstV1I, R9896
    Bst98IC/TTAAGAflIIR0520C/TTAAGAflII, BfrI , BspTI, BstAFI, MspCI, Vha464I
    BstACIGR/CGYCBsaHIR0556GR/CGYCAcyI , BsaHI, BssNI, Hin1I, Hsp92I
    BstAFIC/TTAAGAflIIR0520C/TTAAGAflII, BfrI , BspTI, Bst98I, MspCI, Vha464I
    BstAPIGCANNNN/NTGCBstAPIR0654GCANNNN/NTGCApaBI^
    BstAUIT/GTACABsrGIR0575T/GTACAAauI , Bsp1407I, BsrGI, SspBI
    BstBAIYAC/GTRBsaAIR0531YAC/GTRBsaAI, Ppu21I
    BstBITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, Bsp119I, BspT104I, Csp45I, NspV , SfuI
    BstC8IGCN/NGCCac8IR0579GCN/NGCCac8I
    BstDEIC/TNAGDdeIR0175C/TNAGDdeI, HpyF3I
    BstDSIC/CRYGGBtgIR0608C/CRYGGBtgI, DsaI
    BstEII G/GTNACCBstEII R0162G/GTNACCBstPI, Eco065I, Eco91I, EcoO65I, PspEI
    BstENICCTNN/NNNAGGEcoNIR0521CCTNN/NNNAGGEcoNI, XagI
    BstENII/GATCBfuCIR0636/GATCBfuCI, BscFI, Bsp143I, BssMI, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
    DpnI^R0176GA/TC
    MboIR0147/GATC
    Sau3AIR0169/GATC
    BstF5IGGATG(2/0)BtsCIR0647GGATG(2/0)BseGI, BtsCI, FokI^
    FokI^R0109GGATG(9/13)
    BstFNICG/CGBstUIR0518CG/CGAccII , Bsh1236I, BspFNI^, BstUI, FnuDII^, MvnI, ThaI
    BstH2IRGCGC/YHaeIIR0107RGCGC/YBfoI, Bsp143II, HaeII
    BstHHIGCG/CHhaIR0139GCG/CAspLEI , CfoI, GlaI^, HhaI, R9529^, HinP1I^, HspAI ^
    HinP1I^R0124G/CGC
    BstHPIGTT/AACHpaIR0105GTT/AACHpaI, KspAI
    BstKTIGAT/CBfuCI^R0636/GATCBfuCI^, BscFI^, Bsp143I^, BssMI^, BstENII^, BstMBI^, DpnI^, Kzo9I^, MalI^, MboI^, NdeII^, Sau3AI^
    DpnI^R0176GA/TC
    MboI^R0147/GATC
    Sau3AI^R0169/GATC
    BstMAIGTCTC(1/5)BcoDIR0542GTCTC(1/5)Alw26I , BcoDI, BsmAI, BsoMAI, Nt.BsmAI^
    BsmAIR0529GTCTC(1/5)
    Nt.BsmAI^R0121GTCTC(1/-5)
    BstMBI/GATCBfuCIR0636/GATCBfuCI, BscFI, Bsp143I, BssMI, BstENII, BstKTI^, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
    DpnI^R0176GA/TC
    MboIR0147/GATC
    Sau3AIR0169/GATC
    BstMCICGRY/CGBsiEIR0554CGRY/CGBsaOI, Bsh1285I , BsiEI, McrI
    BstMWIGCNNNNN/NNGCMwoIR0573GCNNNNN/NNGCHpyF10VI, MwoI
    BstNICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BseBI, BsiLI, Bst2UI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
    PspGI^R0611/CCWGG
    BstNSIRCATG/YNspIR0602RCATG/YNspI, XceI
    BstOICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BseBI, BsiLI, Bst2UI, BstNI, EcoRII^, MvaI, Psp6I ^, PspGI^
    PspGI^R0611/CCWGG
    BstPAIGACNN/NNGTCPshAIR0593GACNN/NNGTCBoxI, PshAI
    BstPIG/GTNACCBstEII R0162G/GTNACCBstEII , Eco065I, Eco91I, EcoO65I, PspEI
    BstSCI/CCNGGBssKIR0592/CCNGGBme1390I^, BmrFI^, BssKI, MspR9I^, ScrFI^, StyD4I
    ScrFI^R0110CC/NGG
    StyD4IR0638/CCNGG
    BstSFIC/TRYAGSfcIR0561C/TRYAGBfmI , BpcI, SfcI
    BstSLIGKGCM/CBaeGIR0708GKGCM/CBaeGI, BseSI
    BstSNITAC/GTASnaBIR0130TAC/GTAEco105I, SnaBI
    BstUICG/CGBstUIR0518CG/CGAccII , Bsh1236I, BspFNI^, BstFNI, FnuDII^, MvnI, ThaI
    BstV1IGCAGC(8/12)BbvIR0173GCAGC(8/12)BbvI, BseXI, Bst71I, R9896
    BstV2IGAAGAC(2/6)BbsIR0539GAAGAC(2/6)BbsI, BbvII , BpiI, BpuAI
    BstX2IR/GATCYBstYIR0523R/GATCYBstYI, MflI, PsuI, XhoII
    BstXICCANNNNN/NTGGBstXIR0113CCANNNNN/NTGG
    BstYIR/GATCYBstYIR0523R/GATCYBstX2I, MflI, PsuI, XhoII
    BstZ17IGTA/TACBstZ17IR0594GTA/TACBssNAI, Bst1107I, SnaI^
    BstZIC/GGCCGEagIR0505C/GGCCGBseX3I , EagI, EclXI, Eco52I, XmaIII
    Bsu15IAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, BsuTUI, ClaI, ZhoI
    ClaIR0197AT/CGAT
    Bsu36ICC/TNAGGBsu36IR0524CC/TNAGGAocI , AxyI , Bse21I, CvnI, Eco81I, SauI
    BsuIGTATCC(6/5)BciVIR0596GTATCC(6/5)BciVI, BfuI
    BsuRIGG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BsnI, BspANI, HaeIII, PalI , PhoI
    PhoIR0705GG/CC
    BsuTUIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, ClaI, ZhoI
    ClaIR0197AT/CGAT
    BtgIC/CRYGGBtgIR0608C/CRYGGBstDSI, DsaI
    BtgZIGCGATG(10/14)BtgZIR0703GCGATG(10/14)
    BthCIxGCNG/CFnu4HI^R0178GC/NGCBisI ^, BlsI ^, Fnu4HI^, Fsp4HI^, GluI^, ItaI ^, SatI^
    BtrICACGTC(-3/-3)BmgBI^R0628CACGTC(-3/-3)AjiI ^, BmgBI^
    BtsCIGGATG(2/0)BtsCIR0647GGATG(2/0)BseGI, BstF5I, FokI^
    FokI^R0109GGATG(9/13)
    BtsIGCAGTG(2/0)BtsIR0614GCAGTG(2/0)Nb.BtsI^
    Nb.BtsI^R0707GCAGTG
    BtsIMutICAGTG(2/0)BtsIMutIR0664CAGTG(2/0)
    BtuMITCG/CGANruIR0192TCG/CGABsp68I, NruI, RruI^
    BveIACCTGC(4/8)BfuAIR0701ACCTGC(4/8)Acc36I , BfuAI, BspMI
    BspMIR0502ACCTGC(4/8)
    Cac8IGCN/NGCCac8IR0579GCN/NGCBstC8I
    CaiICAGNNN/CTGAlwNIR0514CAGNNN/CTGAlwNI, PstNI
    CauIIxCC/SGGNciIR0196CC/SGGAsuC2I , BcnI , BpuMI, EcoHI^, NciI
    CchIIxGGARGA(11/9)
    CchIIIxCCCAAG(20/18)
    CciIT/CATGABspHIR0517T/CATGABspHI, PagI , RcaI
    CciNIGC/GGCCGCNotIR0189GC/GGCCGCNotI
    CdiIxCATCG(-1/-1)
    CdpIGCGGAG(20/18)
    CelIIGC/TNAGCBlpIR0585GC/TNAGCBlpI, Bpu1102I, Bsp1720I, EspI
    CfoIGCG/CHhaIR0139GCG/CAspLEI , BstHHI, GlaI^, HhaI, R9529^, HinP1I^, HspAI ^
    HinP1I^R0124G/CGC
    Cfr10IR/CCGGYBsrFIR0562R/CCGGYBse118I, BsrFI, BssAI
    Cfr13IG/GNCCSau96IR0165G/GNCCAspS9I , AsuI , BmgT120I^, BsiZI, BspLI^, FmuI^, PspPI , Sau96I, UnbI^
    Cfr42ICCGC/GGSacIIR0157CCGC/GGKspI, SacII, Sfr303I, SgrBI, SstII
    Cfr9IC/CCGGGSmaI^R0141CCC/GGGPspAI , SmaI^, TspMI, XmaCI
    TspMIR0709C/CCGGG
    CfrIY/GGCCREaeIR0508Y/GGCCRAcoI , EaeI
    CjeFIIIxGCAAGG
    CjeFVxGGRCA
    CjeIx(8/14)CCANNNNNNGT(15/9)
    CjeNIIxGAGNNNNNGT
    CjeNIIIxGKAAYG(19/17)
    CjeP659IVxCACNNNNNNNGAA
    CjePIx(7/13)CCANNNNNNNTC(14/8)
    CjuIxCAYNNNNNRTG
    CjuIIxCAYNNNNNCTC
    ClaIAT/CGATClaIR0197AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ZhoI
    BspDIR0557AT/CGAT
    CpoICG/GWCCG
    CseIGACGC(5/10)HgaIR0154GACGC(5/10)HgaI
    CsiIA/CCWGGTSexAIR0605A/CCWGGTMabI, SexAI
    Csp45ITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, Bsp119I, BspT104I, BstBI, NspV , SfuI
    Csp6IG/TACCviQIR0639G/TACAfaI ^, CviQI, RsaI^
    RsaI^R0167GT/AC
    CspAIA/CCGGTAgeIR0552A/CCGGTAgeI, AsiAI , BshTI, PinAI
    CspCI(11/13)CAANNNNNGTGG(12/10)CspCIR0645(11/13)CAANNNNNGTGG(12/10)
    CspICG/GWCCG
    CstMIxAAGGAG(20/18)
    CviAIIC/ATGCviAIIR0640C/ATGFaeI^, FatI^, Hin1II^, Hsp92II ^, NlaIII^
    FatI^R0650/CATG
    NlaIII^R0125CATG/
    CviJIRG/CY
    CviKI-1RG/CYCviKI-1R0710RG/CYCviJI^, CviTI^
    CviQIG/TACCviQIR0639G/TACAfaI ^, Csp6I, RsaI^
    RsaI^R0167GT/AC
    CviRIxTG/CAHpyCH4VR0620TG/CAHpyCH4V
    CviTIRG/CY
    CvnICC/TNAGGBsu36IR0524CC/TNAGGAocI , AxyI , Bse21I, Bsu36I, Eco81I, SauI
    DdeIC/TNAGDdeIR0175C/TNAGBstDEI, HpyF3I
    DinIGGC/GCCKasI^R0544G/GCGCCBbeI ^, EgeI, KasI^, Mly113I^, NarI^, PluTI^, SfoI, SspDI^
    NarI^R0191GG/CGCC
    PluTI^R0713GGCGC/C
    SfoIR0606GGC/GCC
    DpnIGA/TCDpnIR0176GA/TCBfuCI^, BscFI^, Bsp143I^, BssMI^, BstENII^, BstKTI^, BstMBI^, Kzo9I^, MalI^, MboI^, NdeII^, Sau3AI^
    BfuCI^R0636/GATC
    MboI^R0147/GATC
    Sau3AI^R0169/GATC
    DpnII/GATCDpnIIR0543/GATCBfuCI, BscFI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
    DpnI^R0176GA/TC
    MboIR0147/GATC
    Sau3AIR0169/GATC
    DraITTT/AAADraIR0129TTT/AAAAhaIII ^
    DraIIRG/GNCCYEcoO109IR0503RG/GNCCYEcoO109I, PssI^
    DraIIICACNNN/GTGDraIIIR0510CACNNN/GTGAdeI
    DraRIxCAAGNAC(20/18)
    DrdIGACNNNN/NNGTCDrdIR0530GACNNNN/NNGTCAasI , DseDI
    DrdIIxGAACCA
    DrdIVxTACGAC(20/18)
    DriIGACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, AspEI , BmeRI, Eam1105I, EclHKI, NruGI
    DsaIxC/CRYGGBtgIR0608C/CRYGGBstDSI, BtgI
    DseDIGACNNNN/NNGTCDrdIR0530GACNNNN/NNGTCAasI , DrdI
    EaeIY/GGCCREaeIR0508Y/GGCCRAcoI , CfrI
    EagIC/GGCCGEagIR0505C/GGCCGBseX3I , BstZI, EclXI, Eco52I, XmaIII
    Eam1104ICTCTTC(1/4)EarIR0528CTCTTC(1/4)Bst6I, EarI, Ksp632I
    Eam1105IGACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, AspEI , BmeRI, DriI, EclHKI, NruGI
    EarICTCTTC(1/4)EarIR0528CTCTTC(1/4)Bst6I, Eam1104I, Ksp632I
    EciIGGCGGA(11/9)EciIR0590GGCGGA(11/9)
    Ecl136IIGAG/CTCEco53kIR0116GAG/CTCEco53kI, EcoICRI, Psp124BI ^, SacI^, SstI^
    SacI^R0156GAGCT/C
    EclHKIGACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, AspEI , BmeRI, DriI, Eam1105I, NruGI
    EclXIC/GGCCGEagIR0505C/GGCCGBseX3I , BstZI, EagI, Eco52I, XmaIII
    Eco065IG/GTNACCBstEII R0162G/GTNACCBstEII , BstPI, Eco91I, EcoO65I, PspEI
    Eco105ITAC/GTASnaBIR0130TAC/GTABstSNI, SnaBI
    Eco130IC/CWWGGStyIR0500C/CWWGGBssT1I, EcoT14I, ErhI , StyI
    Eco147IAGG/CCTStuIR0187AGG/CCTAatI , PceI , SseBI, StuI
    Eco24IGRGCY/CBanIIR0119GRGCY/CBanII, EcoT38I, FriOI, HgiJII
    Eco31IGGTCTC(1/5)BsaIR0535GGTCTC(1/5)BsaI, Bso31I, BspTNI
    Eco32IGAT/ATCEcoRVR0195GAT/ATCEcoRV
    Eco47IG/GWCCAvaIIR0153G/GWCCAflI , AvaII, Bme18I, PspO3I^, SinI, Vpak11AI^
    Eco47IIIAGC/GCTAfeIR0652AGC/GCTAfeI, Aor51HI , FunI
    Eco52IC/GGCCGEagIR0505C/GGCCGBseX3I , BstZI, EagI, EclXI, XmaIII
    Eco53kIGAG/CTCEco53kIR0116GAG/CTCEcl136II, EcoICRI, Psp124BI ^, SacI^, SstI^
    SacI^R0156GAGCT/C
    Eco57ICTGAAG(16/14)AcuIR0641CTGAAG(16/14)AcuI
    Eco57MICTGRAG(16/14)
    Eco72ICAC/GTGPmlIR0532CAC/GTGAcvI , BbrPI , PmaCI , PmlI, PspCI
    Eco81ICC/TNAGGBsu36IR0524CC/TNAGGAocI , AxyI , Bse21I, Bsu36I, CvnI, SauI
    Eco88IC/YCGRGAvaIR0152C/YCGRGAma87I , AvaI, BcoI , BmeT110I, BsiHKCI, BsoBI, NspIII
    BsoBIR0586C/YCGRG
    Eco91IG/GTNACCBstEII R0162G/GTNACCBstEII , BstPI, Eco065I, EcoO65I, PspEI
    EcoHIx/CCSGGNciI^R0196CC/SGGAsuC2I ^, BcnI ^, BpuMI^, CauII^, NciI^
    EcoICRIGAG/CTCEco53kIR0116GAG/CTCEcl136II, Eco53kI, Psp124BI ^, SacI^, SstI^
    SacI^R0156GAGCT/C
    EcoNICCTNN/NNNAGGEcoNIR0521CCTNN/NNNAGGBstENI, XagI
    EcoO109IRG/GNCCYEcoO109IR0503RG/GNCCYDraII, PssI^
    EcoO65IG/GTNACCBstEII R0162G/GTNACCBstEII , BstPI, Eco065I, Eco91I, PspEI
    EcoP15ICAGCAG(25/27)EcoP15IR0646CAGCAG(25/27)
    EcoRIG/AATTCEcoRIR0101G/AATTCFunII
    EcoRII/CCWGGBstNI^R0168CC/WGGAjnI ^, BciT130I^, BptI^, BseBI^, BsiLI^, Bst2UI^, BstNI^, BstOI^, MvaI^, Psp6I , PspGI
    PspGIR0611/CCWGG
    EcoRVGAT/ATCEcoRVR0195GAT/ATCEco32I
    EcoT14IC/CWWGGStyIR0500C/CWWGGBssT1I, Eco130I, ErhI , StyI
    EcoT22IATGCA/TNsiIR0127ATGCA/TAvaIII ^, BfrBl, Mph1103I, NsiI, Zsp2I
    EcoT38IGRGCY/CBanIIR0119GRGCY/CBanII, Eco24I, FriOI, HgiJII
    EgeIGGC/GCCKasI^R0544G/GCGCCBbeI ^, DinI, KasI^, Mly113I^, NarI^, PluTI^, SfoI, SspDI^
    NarI^R0191GG/CGCC
    PluTI^R0713GGCGC/C
    SfoIR0606GGC/GCC
    EheIGGC/GCCKasI^R0544G/GCGCCBbeI ^, DinI, EgeI, KasI^, Mly113I^, NarI^, PluTI^, SfoI, SspDI^
    NarI^R0191GG/CGCC
    PluTI^R0713GGCGC/C
    SfoIR0606GGC/GCC
    ErhI C/CWWGGStyIR0500C/CWWGGBssT1I, Eco130I, EcoT14I, StyI
    EsaSSIxGACCAC
    Esp3ICGTCTC(1/5)BsmBIR0580CGTCTC(1/5)BsmBI
    EspIxGC/TNAGCBlpIR0585GC/TNAGCBlpI, Bpu1102I, Bsp1720I, CelII
    FaeICATG/CviAII^R0640C/ATGCviAII^, FatI^, Hin1II, Hsp92II , NlaIII
    FatI^R0650/CATG
    NlaIIIR0125CATG/
    FaiIYA/TR
    FalI(8/13)AAGNNNNNCTT(13/8)
    FaqIGGGAC(10/14)BsmFIR0572GGGAC(10/14)BslFI, BsmFI, FinI^
    FatI/CATGFatIR0650/CATGCviAII^, FaeI^, Hin1II^, Hsp92II ^, NlaIII^
    CviAII^R0640C/ATG
    NlaIII^R0125CATG/
    FauICCCGC(4/6)FauIR0651CCCGC(4/6)SmuI
    FauNDICA/TATGNdeIR0111CA/TATGNdeI
    FbaIT/GATCABclIR0160T/GATCABclI, BsiQI, Ksp22I
    FblIGT/MKACAccIR0161GT/MKACAccI, XmiI
    FinIxGGGACBsmFI^R0572GGGAC(10/14)BslFI^, BsmFI^, FaqI^
    FmuIxGGNC/CSau96I^R0165G/GNCCAspS9I ^, AsuI ^, BmgT120I^, BsiZI^, BspLI^, Cfr13I^, PspPI ^, Sau96I^, UnbI^
    Fnu4HIGC/NGCFnu4HIR0178GC/NGCBisI , BlsI ^, BthCI^, Fsp4HI, GluI, ItaI , SatI
    FnuDIIxCG/CGBstUI^R0518CG/CGAccII ^, Bsh1236I^, BspFNI, BstFNI^, BstUI^, MvnI^, ThaI^
    FokIGGATG(9/13)FokIR0109GGATG(9/13)BseGI^, BstF5I^, BtsCI^
    BtsCI^R0647GGATG(2/0)
    FriOIGRGCY/CBanIIR0119GRGCY/CBanII, Eco24I, EcoT38I, HgiJII
    FseIGGCCGG/CCFseIR0588GGCCGG/CCRigI
    Fsp4HIGC/NGCFnu4HIR0178GC/NGCBisI , BlsI ^, BthCI^, Fnu4HI, GluI, ItaI , SatI
    FspAIRTGC/GCAY
    FspBIC/TAGBfaIR0568C/TAGBfaI, MaeI, XspI
    FspEICC(12/16)FspEIR0662CC(12/16)
    FspITGC/GCAFspIR0135TGC/GCAAcc16I , AviII , MstI, NsbI
    FunIAGC/GCTAfeIR0652AGC/GCTAfeI, Aor51HI , Eco47III
    FunIIG/AATTCEcoRIR0101G/AATTCEcoRI
    GauT27IxCGCGCAGG
    GdiIIxCGGCCR(-5/-1)
    GlaIGC/GCHhaI^R0139GCG/CAspLEI ^, BstHHI^, CfoI^, HhaI^, R9529^, HinP1I^, HspAI ^
    HinP1I^R0124G/CGC
    GluIGC/NGCFnu4HIR0178GC/NGCBisI , BlsI ^, BthCI^, Fnu4HI, Fsp4HI, ItaI , SatI
    GsaICCCAGC(-1/-5)BseYI^R0635CCCAGC(-5/-1)BseYI^
    GsuICTGGAG(16/14)BpmIR0565CTGGAG(16/14)BpmI
    HaeIxWGG/CCW
    HaeIIRGCGC/YHaeIIR0107RGCGC/YBfoI, Bsp143II, BstH2I
    HaeIIIGG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BsnI, BspANI, BsuRI, PalI , PhoI
    PhoIR0705GG/CC
    HaeIVx(7/13)GAYNNNNNRTC(14/9)
    HapIIC/CGGHpaIIR0171C/CGGBsiSI, HpaII, MspI
    MspIR0106C/CGG
    HgaIGACGC(5/10)HgaIR0154GACGC(5/10)CseI
    HgiAIxGWGCW/CBsiHKAIR0570GWGCW/CAlw21I , AspHI , Bbv12I , BsiHKAI
    HgiCIxG/GYRCCBanIR0118G/GYRCCAccB1I , BanI, BshNI, BspT107I
    HgiEIIxACCNNNNNNGGT
    HgiJIIxGRGCY/CBanIIR0119GRGCY/CBanII, Eco24I, EcoT38I, FriOI
    HhaIGCG/CHhaIR0139GCG/CAspLEI , BstHHI, CfoI, GlaI^, R9529^, HinP1I^, HspAI ^
    HinP1I^R0124G/CGC
    Hin1IGR/CGYCBsaHIR0556GR/CGYCAcyI , BsaHI, BssNI, BstACI, Hsp92I
    Hin1IICATG/CviAII^R0640C/ATGCviAII^, FaeI, FatI^, Hsp92II , NlaIII
    FatI^R0650/CATG
    NlaIIIR0125CATG/
    Hin4I(8/13)GAYNNNNNVTC(13/8)
    Hin4IIxCCTTC(6/5)HpyAVR0621CCTTC(6/5)HpyAV
    R9529G/CGCHhaI^R0139GCG/CAspLEI ^, BstHHI^, CfoI^, GlaI^, HhaI^, HinP1I, HspAI
    HinP1IR0124G/CGC
    Hin6IG/CGCHhaI^R0139GCG/CAspLEI ^, BstHHI^, CfoI^, GlaI^, HhaI^, R9529, HinP1I, HspAI
    HinP1IR0124G/CGC
    HincIIGTY/RACHincIIR0103GTY/RAC
    HindIIGTY/RAC
    HindIIIA/AGCTTHindIIIR0104A/AGCTT
    HinfIG/ANTCHinfIR0155G/ANTC
    HinP1IG/CGCHinP1IR0124G/CGCAspLEI ^, BstHHI^, CfoI^, GlaI^, HhaI^, R9529, HspAI
    HhaI^R0139GCG/C
    HpaIGTT/AACHpaIR0105GTT/AACBstHPI, KspAI
    HpaIIC/CGGHpaIIR0171C/CGGBsiSI, HapII, MspI
    MspIR0106C/CGG
    HphIGGTGA(8/7)HphIR0158GGTGA(8/7)AsuHPI
    Hpy166IIGTN/NACHpy166IIR0616GTN/NACHpy8I^, MjaIV^
    Hpy178IIIxTC/NNGAHpy188IIIR0622TC/NNGAHpy188III
    Hpy188ITCN/GAHpy188IR0617TCN/GA
    Hpy188IIITC/NNGAHpy188IIIR0622TC/NNGAHpy178III
    Hpy8IGTN/NACHpy166II^R0616GTN/NACHpy166II^, MjaIV^
    Hpy99ICGWCG/Hpy99IR0615CGWCG/
    Hpy99XIIIxGCCTA
    HpyAVCCTTC(6/5)HpyAVR0621CCTTC(6/5)Hin4II
    HpyCH4IIIACN/GTHpyCH4IIIR0618ACN/GTBst4CI, TaaI, Tsp4CI
    HpyCH4IVA/CGTHpyCH4IVR0619A/CGTHpySE526I, MaeII, TaiI^, TscI^
    HpyCH4VTG/CAHpyCH4VR0620TG/CACviRI
    HpyF10VIGCNNNNN/NNGCMwoIR0573GCNNNNN/NNGCBstMWI, MwoI
    HpyF3IC/TNAGDdeIR0175C/TNAGBstDEI, DdeI
    HpySE526IA/CGTHpyCH4IVR0619A/CGTHpyCH4IV, MaeII, TaiI^, TscI^
    Hsp92IGR/CGYCBsaHIR0556GR/CGYCAcyI , BsaHI, BssNI, BstACI, Hin1I
    Hsp92II CATG/CviAII^R0640C/ATGCviAII^, FaeI, FatI^, Hin1II, NlaIII
    FatI^R0650/CATG
    NlaIIIR0125CATG/
    HspAI G/CGCHhaI^R0139GCG/CAspLEI ^, BstHHI^, CfoI^, GlaI^, HhaI^, R9529, HinP1I
    HinP1IR0124G/CGC
    I-CeuITAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)I-CeuIR0699TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
    I-SceITAGGGATAACAGGGTAAT(-9/-13)I-SceIR0694TAGGGATAACAGGGTAAT(-9/-13)
    ItaI GC/NGCFnu4HIR0178GC/NGCBisI , BlsI ^, BthCI^, Fnu4HI, Fsp4HI, GluI, SatI
    KasIG/GCGCCKasIR0544G/GCGCCBbeI ^, DinI^, EgeI^, Mly113I^, NarI^, PluTI^, SfoI^, SspDI
    NarI^R0191GG/CGCC
    PluTI^R0713GGCGC/C
    SfoI^R0606GGC/GCC
    KflIGG/GWCCC
    Kpn2I T/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, BsiMI, Bsp13I, BspEI, BspMII, MroI
    KpnIGGTAC/CKpnIR0142GGTAC/CAcc65I^, Asp718I ^
    Acc65I^R0599G/GTACC
    KroIG/CCGGCNaeI^R0190GCC/GGCMroNI, NaeI^, NgoAIV, NgoMIV, PdiI ^
    NgoMIVR0564G/CCGGC
    Ksp22I T/GATCABclIR0160T/GATCABclI, BsiQI, FbaI
    Ksp632IxCTCTTC(1/4)EarIR0528CTCTTC(1/4)Bst6I, Eam1104I, EarI
    Ksp632IxCTCTTC(1/4)EarIR0528CTCTTC(1/4)Bst6I, Eam1104I, EarI, Ksp632I
    KspAIGTT/AACHpaIR0105GTT/AACBstHPI, HpaI
    KspICCGC/GGSacIIR0157CCGC/GGCfr42I, SacII, Sfr303I, SgrBI, SstII
    Kzo9I/GATCBfuCIR0636/GATCBfuCI, BscFI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, MalI^, MboI, NdeII^, Sau3AI
    DpnI^R0176GA/TC
    MboIR0147/GATC
    Sau3AIR0169/GATC
    LguIGCTCTTC(1/4)BspQIR0712GCTCTTC(1/4)BspQI, Nt.BspQI^, PciSI , SapI
    Nt.BspQI^R0644GCTCTTC(1/-7)
    SapIR0569GCTCTTC(1/4)
    LlaGIxCTNGAYG
    LpnPICCDG(10/14)LpnPIR0663CCDG(10/14)
    LweIGCATC(5/9)SfaNIR0172GCATC(5/9)BmsI, SfaNI
    MabIA/CCWGGTSexAIR0605A/CCWGGTCsiI, SexAI
    MaeIC/TAGBfaIR0568C/TAGBfaI, FspBI, XspI
    MaeIIA/CGTHpyCH4IVR0619A/CGTHpyCH4IV, HpySE526I, TaiI^, TscI^
    MaeIII/GTNAC
    MalIGA/TCBfuCI^R0636/GATCBfuCI^, BscFI^, Bsp143I^, BssMI^, BstENII^, BstKTI^, BstMBI^, DpnI^, Kzo9I^, MboI^, NdeII^, Sau3AI^
    DpnI^R0176GA/TC
    MboI^R0147/GATC
    Sau3AI^R0169/GATC
    MamIGATNN/NNATCBsaBIR0537GATNN/NNATCBsaBI, Bse8I, BseJI, BsiBI, BsrBRI
    MaqIxCRTTGAC(21/19)
    MauBICG/CGCGCG
    MbiICCGCTC(-3/-3)BsrBIR0102CCGCTC(-3/-3)AccBSI , BsrBI
    MboI/GATCMboIR0147/GATCBfuCI, BscFI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, NdeII^, Sau3AI
    BfuCIR0636/GATC
    DpnI^R0176GA/TC
    Sau3AIR0169/GATC
    MboIIGAAGA(8/7)MboIIR0148GAAGA(8/7)
    McrIxCGRY/CGBsiEIR0554CGRY/CGBsaOI, Bsh1285I , BsiEI, BstMCI
    MfeIC/AATTGMfeIR0589C/AATTGMunI
    MflIR/GATCYBstYIR0523R/GATCYBstX2I, BstYI, PsuI, XhoII
    MhlIGDGCH/CBsp1286IR0120GDGCH/CBmyI, Bsp1286I, SduI
    MjaIVxGTNNACHpy166II^R0616GTN/NACHpy166II^, Hpy8I^
    MlsITGG/CCAMscIR0534TGG/CCABalI , MluNI, MscI, Msp20I
    MluCI/AATTMluCIR0538/AATTSse9I, TasI, Tsp509I, TspEI
    Tsp509IR0576/AATT
    MluIA/CGCGTMluIR0198A/CGCGT
    MluNITGG/CCAMscIR0534TGG/CCABalI , MlsI, MscI, Msp20I
    Mly113IGG/CGCCKasI^R0544G/GCGCCBbeI ^, DinI^, EgeI^, KasI^, NarI, PluTI^, SfoI^, SspDI^
    NarIR0191GG/CGCC
    PluTI^R0713GGCGC/C
    SfoI^R0606GGC/GCC
    MlyIGAGTC(5/5)MlyIR0610GAGTC(5/5)Nt.BstNBI^, PleI^, PpsI ^, SchI
    Nt.BstNBI^R0607GAGTC(4/-5)
    PleI^R0515GAGTC(4/5)
    MmeITCCRAC(20/18)MmeIR0637TCCRAC(20/18)
    MnlICCTC(7/6)MnlIR0163CCTC(7/6)
    Mph1103IATGCA/TNsiIR0127ATGCA/TAvaIII ^, BfrBl, EcoT22I, NsiI, Zsp2I
    MreICG/CCGGCG
    MroIT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, BsiMI, Bsp13I, BspEI, BspMII, Kpn2I
    MroNIG/CCGGCNaeI^R0190GCC/GGCKroI, NaeI^, NgoAIV, NgoMIV, PdiI ^
    NgoMIVR0564G/CCGGC
    MroXIGAANN/NNTTCXmnIR0194GAANN/NNTTCAsp700I , PdmI , XmnI
    MscITGG/CCAMscIR0534TGG/CCABalI , MlsI, MluNI, Msp20I
    MseIT/TAAMseIR0525T/TAASaqAI, Tru1I
    MslICAYNN/NNRTGMslIR0571CAYNN/NNRTGRseI^, SmiMI
    Msp20ITGG/CCAMscIR0534TGG/CCABalI , MlsI, MluNI, MscI
    MspA1ICMG/CKGMspA1IR0577CMG/CKGNspBII
    MspCIC/TTAAGAflIIR0520C/TTAAGAflII, BfrI , BspTI, Bst98I, BstAFI, Vha464I
    MspIC/CGGMspIR0106C/CGGBsiSI, HapII, HpaII
    HpaIIR0171C/CGG
    MspJICNNR(9/13)MspJIR0661CNNR(9/13)
    MspR9ICC/NGGBssKI^R0592/CCNGGBme1390I, BmrFI, BssKI^, BstSCI^, ScrFI, StyD4I^
    ScrFIR0110CC/NGG
    StyD4I^R0638/CCNGG
    MssIGTTT/AAACPmeIR0560GTTT/AAACPmeI
    MstIxTGC/GCAFspIR0135TGC/GCAAcc16I , AviII , FspI, NsbI
    MunIC/AATTGMfeIR0589C/AATTGMfeI
    Mva1269IGAATGC(1/-1)BsmIR0134GAATGC(1/-1)BsaMI, BscCI, BsmI, Nb.BsmI^, PctI
    Nb.BsmI^R0706GAATGC
    MvaICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BseBI, BsiLI, Bst2UI, BstNI, BstOI, EcoRII^, Psp6I ^, PspGI^
    PspGI^R0611/CCWGG
    MvnICG/CGBstUIR0518CG/CGAccII , Bsh1236I, BspFNI^, BstFNI, BstUI, FnuDII^, ThaI
    MvrICGAT/CGPvuIR0150CGAT/CGBpvUI, BspCI, Ple19I , PvuI
    MwoIGCNNNNN/NNGCMwoIR0573GCNNNNN/NNGCBstMWI, HpyF10VI
    NaeIGCC/GGCNaeIR0190GCC/GGCKroI^, MroNI^, NgoAIV^, NgoMIV^, PdiI
    NgoMIV^R0564G/CCGGC
    NarIGG/CGCCNarIR0191GG/CGCCBbeI ^, DinI^, EgeI^, KasI^, Mly113I, PluTI^, SfoI^, SspDI^
    KasI^R0544G/GCGCC
    PluTI^R0713GGCGC/C
    SfoI^R0606GGC/GCC
    Nb.BbvCICCTCAGCNb.BbvCIR0631CCTCAGCBbvCI^, Nt.BbvCI^
    BbvCI^R0601CCTCAGC(-5/-2)
    Nt.BbvCI^R0632CCTCAGC(-5/-7)
    Nb.BsmIGAATGCNb.BsmIR0706GAATGCBsaMI^, BscCI^, BsmI^, Mva1269I^, PctI ^
    BsmI^R0134GAATGC(1/-1)
    Nb.BsrDIGCAATGNb.BsrDIR0648GCAATGBse3DI^, BseMI^, BsrDI^
    BsrDI^R0574GCAATG(2/0)
    Nb.BtsIGCAGTGNb.BtsIR0707GCAGTGBtsI^
    BtsI^R0614GCAGTG(2/0)
    NciICC/SGGNciIR0196CC/SGGAsuC2I , BcnI , BpuMI, CauII, EcoHI^
    NcoIC/CATGGNcoIR0193C/CATGGBsp19I
    NdeICA/TATGNdeIR0111CA/TATGFauNDI
    NdeII/GATCBfuCI^R0636/GATCBfuCI^, BscFI^, Bsp143I^, BssMI^, BstENII^, BstKTI^, BstMBI^, DpnI^, Kzo9I^, MalI^, MboI^, Sau3AI^
    DpnI^R0176GA/TC
    MboI^R0147/GATC
    Sau3AI^R0169/GATC
    NgoAIVG/CCGGCNaeI^R0190GCC/GGCKroI, MroNI, NaeI^, NgoMIV, PdiI ^
    NgoMIVR0564G/CCGGC
    NgoAVIIIx(12/14)GACNNNNNTGA(13/11)
    NgoMIVG/CCGGCNgoMIVR0564G/CCGGCKroI, MroNI, NaeI^, NgoAIV, PdiI ^
    NaeI^R0190GCC/GGC
    NhaXIxCAAGRAG
    NheIG/CTAGCNheIR0131G/CTAGCAsuNHI , BmtI^, BspOI^
    BmtI^R0658GCTAG/C
    NlaCIxCATCAC(19/17)
    NlaIIICATG/NlaIIIR0125CATG/CviAII^, FaeI, FatI^, Hin1II, Hsp92II
    CviAII^R0640C/ATG
    FatI^R0650/CATG
    NlaIVGGN/NCCNlaIVR0126GGN/NCCBmiI, BscBI, PspN4I
    NmeAIIIGCCGAG(21/19)NmeAIIIR0711GCCGAG(21/19)
    NmuCI/GTSACTsp45IR0583/GTSACTseFI^, Tsp45I
    NotIGC/GGCCGCNotIR0189GC/GGCCGCCciNI
    NruGI GACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, AspEI , BmeRI, DriI, Eam1105I, EclHKI
    NruITCG/CGANruIR0192TCG/CGABsp68I, BtuMI, RruI^
    NsbI TGC/GCAFspIR0135TGC/GCAAcc16I , AviII , FspI, MstI
    NsiIATGCA/TNsiIR0127ATGCA/TAvaIII ^, BfrBl, EcoT22I, Mph1103I, Zsp2I
    NspBII xCMG/CKGMspA1IR0577CMG/CKGMspA1I
    NspIRCATG/YNspIR0602RCATG/YBstNSI, XceI
    NspIII C/YCGRGAvaIR0152C/YCGRGAma87I , AvaI, BcoI , BmeT110I, BsiHKCI, BsoBI, Eco88I
    BsoBIR0586C/YCGRG
    NspV TT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, Bsp119I, BspT104I, BstBI, Csp45I, SfuI
    Nt.AlwIGGATC(4/-5)Nt.AlwIR0627GGATC(4/-5)AclWI ^, AlwI^, BinI^, BspPI^
    AlwI^R0513GGATC(4/5)
    Nt.BbvCICCTCAGC(-5/-7)Nt.BbvCIR0632CCTCAGC(-5/-7)BbvCI^, Nb.BbvCI^
    BbvCI^R0601CCTCAGC(-5/-2)
    Nb.BbvCI^R0631CCTCAGC
    Nt.BsmAIGTCTC(1/-5)Nt.BsmAIR0121GTCTC(1/-5)Alw26I ^, BcoDI^, BsmAI^, BsoMAI^, BstMAI^
    BcoDI^R0542GTCTC(1/5)
    BsmAI^R0529GTCTC(1/5)
    Nt.BspQIGCTCTTC(1/-7)Nt.BspQIR0644GCTCTTC(1/-7)BspQI^, LguI^, PciSI ^, SapI^
    BspQI^R0712GCTCTTC(1/4)
    SapI^R0569GCTCTTC(1/4)
    Nt.BstNBIGAGTC(4/-5)Nt.BstNBIR0607GAGTC(4/-5)MlyI^, PleI^, PpsI ^, SchI^
    MlyI^R0610GAGTC(5/5)
    PleI^R0515GAGTC(4/5)
    Nt.CviPII(0/-1)CCDNt.CviPIIR0626(0/-1)CCD
    OliI CACNN/NNGTGAleIR0634CACNN/NNGTGAleI
    PacITTAAT/TAAPacIR0547TTAAT/TAA
    PaeI GCATG/CSphI-HF™R3182GCATG/CBbuI , SpaHI, SphI-HF™
    PaeR7IC/TCGAGPaeR7IR0177C/TCGAGBssHI, Sfr274I, SlaI, StrI, TliI, XhoI
    TliIR0612C/TCGAG
    XhoIR0146C/TCGAG
    PagI T/CATGABspHIR0517T/CATGABspHI, CciI, RcaI
    PalAI GG/CGCGCCAscIR0558GG/CGCGCCAscI, SgsI
    PalI GG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BsnI, BspANI, BsuRI, HaeIII, PhoI
    PhoIR0705GG/CC
    PasI CC/CWGGG
    PauI G/CGCGCBssHIIR0199G/CGCGCBsePI, BssHII, PteI
    PceI AGG/CCTStuIR0187AGG/CCTAatI , Eco147I, SseBI, StuI
    PciIA/CATGTPciIR0655A/CATGTBspLU11I, PscI
    PciSI GCTCTTC(1/4)BspQIR0712GCTCTTC(1/4)BspQI, LguI, Nt.BspQI^, SapI
    Nt.BspQI^R0644GCTCTTC(1/-7)
    SapIR0569GCTCTTC(1/4)
    PcsIWCGNNNN/NNNCGW
    PctI GAATGC(1/-1)BsmIR0134GAATGC(1/-1)BsaMI, BscCI, BsmI, Mva1269I, Nb.BsmI^
    Nb.BsmI^R0706GAATGC
    PdiI GCC/GGCNaeIR0190GCC/GGCKroI^, MroNI^, NaeI, NgoAIV^, NgoMIV^
    NgoMIV^R0564G/CCGGC
    PdmI GAANN/NNTTCXmnIR0194GAANN/NNTTCAsp700I , MroXI, XmnI
    PenIxGCAGT
    PfeI G/AWTCTfiIR0546G/AWTCTfiI
    Pfl1108I xTCGTAG
    Pfl23II C/GTACGBsiWIR0553C/GTACGBsiWI, PspLI , SplI, SunI
    PflBI CCANNNN/NTGGPflMIR0509CCANNNN/NTGGAccB7I , BasI , PflMI, Van91I
    PflFIGACN/NNGTCPflFIR0595GACN/NNGTCAspI , PsyI, TelI, Tth111I
    Tth111IR0185GACN/NNGTC
    PflMICCANNNN/NTGGPflMIR0509CCANNNN/NTGGAccB7I , BasI , PflBI , Van91I
    PfoI T/CCNGGA
    PhoIGG/CCPhoIR0705GG/CCAoxI^, BshFI , BsnI, BspANI, BsuRI, HaeIII, PalI
    HaeIIIR0108GG/CC
    PinAI A/CCGGTAgeIR0552A/CCGGTAgeI, AsiAI , BshTI, CspAI
    PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)PI-PspIR0695TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
    PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)PI-SceIR0696ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
    PlaDIxCATCAG(21/19)
    Ple19I CGAT/CGPvuIR0150CGAT/CGBpvUI, BspCI, MvrI, PvuI
    PleIGAGTC(4/5)PleIR0515GAGTC(4/5)MlyI^, Nt.BstNBI^, PpsI , SchI^
    MlyI^R0610GAGTC(5/5)
    Nt.BstNBI^R0607GAGTC(4/-5)
    PluTIGGCGC/CPluTIR0713GGCGC/CBbeI , DinI^, EgeI^, KasI^, Mly113I^, NarI^, SfoI^, SspDI^
    KasI^R0544G/GCGCC
    NarI^R0191GG/CGCC
    SfoI^R0606GGC/GCC
    PmaCI CAC/GTGPmlIR0532CAC/GTGAcvI , BbrPI , Eco72I, PmlI, PspCI
    PmeIGTTT/AAACPmeIR0560GTTT/AAACMssI
    PmlICAC/GTGPmlIR0532CAC/GTGAcvI , BbrPI , Eco72I, PmaCI , PspCI
    PpiI (7/12)GAACNNNNNCTC(13/8)
    PpsI GAGTC(4/5)MlyI^R0610GAGTC(5/5)MlyI^, Nt.BstNBI^, PleI, SchI^
    Nt.BstNBI^R0607GAGTC(4/-5)
    PleIR0515GAGTC(4/5)
    Ppu21I YAC/GTRBsaAIR0531YAC/GTRBsaAI, BstBAI
    PpuMIRG/GWCCYPpuMIR0506RG/GWCCYPsp5II
    PpuXI RG/GWCCYPpuMIR0506RG/GWCCYPpuMI, Psp5II
    PscI A/CATGTPciIR0655A/CATGTBspLU11I, PciI
    PshAIGACNN/NNGTCPshAIR0593GACNN/NNGTCBoxI, BstPAI
    PshBI AT/TAATAseIR0526AT/TAATAseI, AsnI , VspI
    PsiITTA/TAAPsiIR0657TTA/TAAAanI
    Psp124BI GAGCT/CEco53kI^R0116GAG/CTCEcl136II^, Eco53kI^, EcoICRI^, SacI, SstI
    SacIR0156GAGCT/C
    Psp1406I AA/CGTTAclIR0598AA/CGTTAclI
    Psp5II RG/GWCCYPpuMIR0506RG/GWCCYPpuMI
    Psp6I /CCWGGBstNI^R0168CC/WGGAjnI ^, BciT130I^, BptI^, BseBI^, BsiLI^, Bst2UI^, BstNI^, BstOI^, EcoRII, MvaI^, PspGI
    PspGIR0611/CCWGG
    PspAI C/CCGGGSmaI^R0141CCC/GGGCfr9I, SmaI^, TspMI, XmaCI
    TspMIR0709C/CCGGG
    PspCI CAC/GTGPmlIR0532CAC/GTGAcvI , BbrPI , Eco72I, PmaCI , PmlI
    PspEI G/GTNACCBstEII R0162G/GTNACCBstEII , BstPI, Eco065I, Eco91I, EcoO65I
    PspGI/CCWGGPspGIR0611/CCWGGAjnI ^, BciT130I^, BptI^, BseBI^, BsiLI^, Bst2UI^, BstNI^, BstOI^, EcoRII, MvaI^, Psp6I
    BstNI^R0168CC/WGG
    PspLI C/GTACGBsiWIR0553C/GTACGBsiWI, Pfl23II , SplI, SunI
    PspN4I GGN/NCCNlaIVR0126GGN/NCCBmiI, BscBI, NlaIV
    PspO3IxGGWC/CAvaII^R0153G/GWCCAflI ^, AvaII^, Bme18I^, Eco47I^, SinI^, Vpak11AI^
    PspOMIG/GGCCCPspOMIR0653G/GGCCCApaI^, Bsp120I
    ApaI^R0114GGGCC/C
    PspOMIIxCGCCCAR(20/18)
    PspPI G/GNCCSau96IR0165G/GNCCAspS9I , AsuI , BmgT120I^, BsiZI, BspLI^, Cfr13I, FmuI^, Sau96I, UnbI^
    PspPRIxCCYCAG(15/13)
    PspXIVC/TCGAGBPspXIR0656VC/TCGAGB
    PsrI(7/12)GAACNNNNNNTAC(12/7)
    PssIxRGGNC/CYEcoO109I^R0503RG/GNCCYDraII^, EcoO109I^
    PstICTGCA/GPstIR0140CTGCA/GBspMAI
    PstNICAGNNN/CTGAlwNIR0514CAGNNN/CTGAlwNI, CaiI
    PsuIR/GATCYBstYIR0523R/GATCYBstX2I, BstYI, MflI, XhoII
    PsyIGACN/NNGTCPflFIR0595GACN/NNGTCAspI , PflFI, TelI, Tth111I
    Tth111IR0185GACN/NNGTC
    PteIG/CGCGCBssHIIR0199G/CGCGCBsePI, BssHII, PauI
    PvuICGAT/CGPvuIR0150CGAT/CGBpvUI, BspCI, MvrI, Ple19I
    PvuIICAG/CTGPvuIIR0151CAG/CTG
    R9896GCAGC(8/12)BbvIR0173GCAGC(8/12)BbvI, BseXI, Bst71I, BstV1I
    RcaIT/CATGABspHIR0517T/CATGABspHI, CciI, PagI
    RceIxCATCGAC(20/18)
    RdeGBIxCCGCAG
    RdeGBIIxACCCAG(20/18)
    RdeGBIIIx(9/11)TGRYCA(11/9)
    RflFIIIxCGCCAG
    RgaIGCGAT/CGCAsiSIR0630GCGAT/CGCAsiSI, SfaAI, SgfI
    RigIGGCCGG/CCFseIR0588GGCCGG/CCFseI
    RlaIxVCW
    RleAIxCCCACA(12/9)
    RpaB5IxCGRGGAC(20/18)
    RpaBIxCCCGCAG(20/18)
    RpaIxGTYGGAG(11/9)
    RpaTIxGRTGGAG
    RruITCG/CGANruI^R0192TCG/CGABsp68I^, BtuMI^, NruI^
    RsaIGT/ACRsaIR0167GT/ACAfaI , Csp6I^, CviQI^
    CviQI^R0639G/TAC
    RsaNIG/TACCviQIR0639G/TACAfaI ^, Csp6I, CviQI, RsaI^
    RsaI^R0167GT/AC
    RseICAYNN/NNRTGMslI^R0571CAYNN/NNRTGMslI^, SmiMI^
    Rsr2ICG/GWCCG
    RsrIICG/GWCCGRsrIIR0501CG/GWCCGCpoI, CspI, Rsr2I
    SacIGAGCT/CSacIR0156GAGCT/CEcl136II^, Eco53kI^, EcoICRI^, Psp124BI , SstI
    Eco53kI^R0116GAG/CTC
    SacIICCGC/GGSacIIR0157CCGC/GGCfr42I, KspI, Sfr303I, SgrBI, SstII
    SalIG/TCGACSalIR0138G/TCGAC
    SanDIxGG/GWCCC
    SapIGCTCTTC(1/4)SapIR0569GCTCTTC(1/4)BspQI, LguI, Nt.BspQI^, PciSI
    BspQIR0712GCTCTTC(1/4)
    Nt.BspQI^R0644GCTCTTC(1/-7)
    SaqAIT/TAAMseIR0525T/TAAMseI, Tru1I
    SatIGC/NGCFnu4HIR0178GC/NGCBisI , BlsI ^, BthCI^, Fnu4HI, Fsp4HI, GluI, ItaI
    Sau3AI/GATCSau3AIR0169/GATCBfuCI, BscFI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^
    BfuCIR0636/GATC
    DpnI^R0176GA/TC
    MboIR0147/GATC
    Sau96IG/GNCCSau96IR0165G/GNCCAspS9I , AsuI , BmgT120I^, BsiZI, BspLI^, Cfr13I, FmuI^, PspPI , UnbI^
    SauIxCC/TNAGGBsu36IR0524CC/TNAGGAocI , AxyI , Bse21I, Bsu36I, CvnI, Eco81I
    SbfICCTGCA/GGSbfIR0642CCTGCA/GGSdaI, Sse8387I
    ScaIAGT/ACTScaIR0122AGT/ACTAcc113I , AssI , BmcAI^, ZrmI
    SchIGAGTC(5/5)MlyIR0610GAGTC(5/5)MlyI, Nt.BstNBI^, PleI^, PpsI ^
    Nt.BstNBI^R0607GAGTC(4/-5)
    PleI^R0515GAGTC(4/5)
    ScrFICC/NGGScrFIR0110CC/NGGBme1390I, BmrFI, BssKI^, BstSCI^, MspR9I, StyD4I^
    BssKI^R0592/CCNGG
    StyD4I^R0638/CCNGG
    SdaICCTGCA/GGSbfIR0642CCTGCA/GGSbfI, Sse8387I
    SdeAIxCAGRAG(21/19)
    SdeOSIx(11/-1)GACNNNNRTGA(12/-11)
    SduIGDGCH/CBsp1286IR0120GDGCH/CBmyI, Bsp1286I, MhlI
    SecIxC/CNNGGBsaJIR0536C/CNNGGBsaJI, BseDI, BssECI
    SetIASST/
    SexAIA/CCWGGTSexAIR0605A/CCWGGTCsiI, MabI
    SfaAIGCGAT/CGCAsiSIR0630GCGAT/CGCAsiSI, RgaI, SgfI
    SfaNIGCATC(5/9)SfaNIR0172GCATC(5/9)BmsI, LweI
    SfcIC/TRYAGSfcIR0561C/TRYAGBfmI , BpcI, BstSFI
    SfeIxC/TRYAGSfcIR0561C/TRYAGBfmI , BpcI, BstSFI, SfcI
    SfiIGGCCNNNN/NGGCCSfiIR0123GGCCNNNN/NGGCC
    SfoIGGC/GCCSfoIR0606GGC/GCCBbeI ^, DinI, EgeI, KasI^, Mly113I^, NarI^, PluTI^, SspDI^
    KasI^R0544G/GCGCC
    NarI^R0191GG/CGCC
    PluTI^R0713GGCGC/C
    Sfr274IC/TCGAGPaeR7IR0177C/TCGAGBssHI, PaeR7I, SlaI, StrI, TliI, XhoI
    TliIR0612C/TCGAG
    XhoIR0146C/TCGAG
    Sfr303ICCGC/GGSacIIR0157CCGC/GGCfr42I, KspI, SacII, SgrBI, SstII
    SfuITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, Bsp119I, BspT104I, BstBI, Csp45I, NspV
    SgeICNNGNNNNNNNNN/NNNN
    SgfIGCGAT/CGCAsiSIR0630GCGAT/CGCAsiSI, RgaI, SfaAI
    SgrAICR/CCGGYGSgrAIR0603CR/CCGGYG
    SgrBICCGC/GGSacIIR0157CCGC/GGCfr42I, KspI, SacII, Sfr303I, SstII
    SgrDICG/TCGACG
    SgrTIxCCDS(10/14)
    SgsIGG/CGCGCCAscIR0558GG/CGCGCCAscI, PalAI
    SimIxGGGTC(-3/0)
    SinIG/GWCCAvaIIR0153G/GWCCAflI , AvaII, Bme18I, Eco47I, PspO3I^, Vpak11AI^
    SlaIC/TCGAGPaeR7IR0177C/TCGAGBssHI, PaeR7I, Sfr274I, StrI, TliI, XhoI
    TliIR0612C/TCGAG
    XhoIR0146C/TCGAG
    SmaICCC/GGGSmaIR0141CCC/GGGCfr9I^, PspAI ^, TspMI^, XmaCI^
    TspMI^R0709C/CCGGG
    SmiIATTT/AAATSwaIR0604ATTT/AAATSwaI
    SmiMICAYNN/NNRTGMslIR0571CAYNN/NNRTGMslI, RseI^
    SmlIC/TYRAGSmlIR0597C/TYRAG
    SmoIC/TYRAG
    SmuICCCGC(4/6)FauIR0651CCCGC(4/6)FauI
    SnaBITAC/GTASnaBIR0130TAC/GTABstSNI, Eco105I
    SnaIxGTATACBstZ17I^R0594GTA/TACBssNAI^, Bst1107I^, BstZ17I^
    Sno506IxGGCCGAG
    SpaHIGCATG/CSphI-HF™R3182GCATG/CBbuI , PaeI , SphI-HF™
    SpeIA/CTAGTSpeIR0133A/CTAGTAhlI , BcuI
    SphIGCATG/CSphIR0182GCATG/CBbuI , PaeI , SpaHI, SphI-HF™
    SplIxC/GTACGBsiWIR0553C/GTACGBsiWI, Pfl23II , PspLI , SunI
    SpoDIxGCGGRAG
    SrfIxGCCC/GGGC
    Sse232IxCG/CCGGCG
    Sse8387ICCTGCA/GGSbfIR0642CCTGCA/GGSbfI, SdaI
    Sse8647IxAG/GWCCT
    Sse9I/AATTMluCIR0538/AATTMluCI, TasI, Tsp509I, TspEI
    Tsp509IR0576/AATT
    SseBIAGG/CCTStuIR0187AGG/CCTAatI , Eco147I, PceI , StuI
    SsiICCGC(-3/-1)AciIR0551CCGC(-3/-1)AciI, BspACI
    SspBIxT/GTACABsrGIR0575T/GTACAAauI , Bsp1407I, BsrGI, BstAUI
    SspDIG/GCGCCKasIR0544G/GCGCCBbeI ^, DinI^, EgeI^, KasI, Mly113I^, NarI^, PluTI^, SfoI^
    NarI^R0191GG/CGCC
    PluTI^R0713GGCGC/C
    SfoI^R0606GGC/GCC
    SspIAAT/ATTSspIR0132AAT/ATT
    SstE37IxCGAAGAC(20/18)
    SstIGAGCT/CEco53kI^R0116GAG/CTCEcl136II^, Eco53kI^, EcoICRI^, Psp124BI , SacI
    SacIR0156GAGCT/C
    SstIICCGC/GGSacIIR0157CCGC/GGCfr42I, KspI, SacII, Sfr303I, SgrBI
    Sth132IxCCCG(4/8)
    StrIC/TCGAGPaeR7IR0177C/TCGAGBssHI, PaeR7I, Sfr274I, SlaI, TliI, XhoI
    TliIR0612C/TCGAG
    XhoIR0146C/TCGAG
    StuIAGG/CCTStuIR0187AGG/CCTAatI , Eco147I, PceI , SseBI
    StyD4I/CCNGGStyD4IR0638/CCNGGBme1390I^, BmrFI^, BssKI, BstSCI, MspR9I^, ScrFI^
    BssKIR0592/CCNGG
    ScrFI^R0110CC/NGG
    StyIC/CWWGGStyIR0500C/CWWGGBssT1I, Eco130I, EcoT14I, ErhI
    SunIC/GTACGBsiWIR0553C/GTACGBsiWI, Pfl23II , PspLI , SplI
    SwaIATTT/AAATSwaIR0604ATTT/AAATSmiI
    TaaIACN/GTHpyCH4IIIR0618ACN/GTBst4CI, HpyCH4III, Tsp4CI
    TaiIACGT/HpyCH4IV^R0619A/CGTHpyCH4IV^, HpySE526I^, MaeII^, TscI
    TaqαIT/CGATaqαIR0149T/CGATthHB8I
    TaqIT/CGATaqαIR0149T/CGATaqαI, TthHB8I
    TaqIIGACCGA(11/9)
    TasI/AATTMluCIR0538/AATTMluCI, Sse9I, Tsp509I, TspEI
    Tsp509IR0576/AATT
    TatIW/GTACW
    TauIGCSG/C
    TelIGACN/NNGTCPflFIR0595GACN/NNGTCAspI , PflFI, PsyI, Tth111I
    Tth111IR0185GACN/NNGTC
    TfiIG/AWTCTfiIR0546G/AWTCPfeI
    ThaICG/CGBstUIR0518CG/CGAccII , Bsh1236I, BspFNI^, BstFNI, BstUI, FnuDII^, MvnI
    TliIC/TCGAGTliIR0612C/TCGAGBssHI, PaeR7I, Sfr274I, SlaI, StrI, XhoI
    PaeR7IR0177C/TCGAG
    XhoIR0146C/TCGAG
    Tru1IT/TAAMseIR0525T/TAAMseI, SaqAI
    Tru9IT/TAAMseIR0525T/TAAMseI, SaqAI, Tru1I
    TscAINNCASTGNN/TspRIR0582NNCASTGNN/TspRI
    TscIACGT/HpyCH4IV^R0619A/CGTHpyCH4IV^, HpySE526I^, MaeII^, TaiI
    TseFIGTSAC/Tsp45I^R0583/GTSACNmuCI^, Tsp45I^
    TseIG/CWGCTseIR0591G/CWGCApeKI
    ApeKIR0643G/CWGC
    TsoITARCCA(11/9)
    Tsp45I/GTSACTsp45IR0583/GTSACNmuCI, TseFI^
    Tsp4CIxACN/GTHpyCH4IIIR0618ACN/GTBst4CI, HpyCH4III, TaaI
    Tsp509I/AATTTsp509IR0576/AATTMluCI, Sse9I, TasI, TspEI
    MluCIR0538/AATT
    TspDTIATGAA(11/9)
    TspEIx/AATTMluCIR0538/AATTMluCI, Sse9I, TasI, Tsp509I
    Tsp509IR0576/AATT
    TspEIx/AATTMluCIR0538/AATTMluCI, Sse9I, TasI, Tsp509I, TspEI
    Tsp509IR0576/AATT
    TspGWIACGGA(11/9)
    TspMIC/CCGGGTspMIR0709C/CCGGGCfr9I, PspAI , SmaI^, XmaCI
    SmaI^R0141CCC/GGG
    TspRINNCASTGNN/TspRIR0582NNCASTGNN/TscAI
    TssIxGAGNNNCTC
    TstI(8/13)CACNNNNNNTCC(12/7)
    TsuIxGCGAC
    Tth111IGACN/NNGTCTth111IR0185GACN/NNGTCAspI , PflFI, PsyI, TelI
    PflFIR0595GACN/NNGTC
    Tth111IIxCAARCA(11/9)
    TthHB8IT/CGATaqαIR0149T/CGATaqαI
    UbaF11IxTCGTA
    UbaF12IxCTACNNNGTC
    UbaF13IxGAGNNNNNNCTGG
    UbaF14IxCCANNNNNTCG
    UbaF9IxTACNNNNNRTGT
    UbaPIxCGAACG
    UnbIx/GGNCCSau96I^R0165G/GNCCAspS9I ^, AsuI ^, BmgT120I^, BsiZI^, BspLI^, Cfr13I^, FmuI^, PspPI ^, Sau96I^
    Van91ICCANNNN/NTGGPflMIR0509CCANNNN/NTGGAccB7I , BasI , PflBI , PflMI
    Vha464IC/TTAAGAflIIR0520C/TTAAGAflII, BfrI , BspTI, Bst98I, BstAFI, MspCI
    VneIG/TGCACApaLIR0507G/TGCACAlw44I , ApaLI
    Vpak11AIx/GGWCCAvaII^R0153G/GWCCAflI ^, AvaII^, Bme18I^, Eco47I^, PspO3I^, SinI^
    VpaK11BIG/GWCCAvaIIR0153G/GWCCAflI , AvaII, Bme18I, Eco47I, PspO3I^, SinI, Vpak11AI^
    VspIAT/TAATAseIR0526AT/TAATAseI, AsnI , PshBI
    WviIxCACRAG(20/18)
    XagICCTNN/NNNAGGEcoNIR0521CCTNN/NNNAGGBstENI, EcoNI
    XapIR/AATTYApoIR0566R/AATTYAcsI , ApoI
    XbaIT/CTAGAXbaIR0145T/CTAGA
    XceIRCATG/YNspIR0602RCATG/YBstNSI, NspI
    XcmICCANNNNN/NNNNTGGXcmIR0533CCANNNNN/NNNNTGG
    XhoIC/TCGAGXhoIR0146C/TCGAGBssHI, PaeR7I, Sfr274I, SlaI, StrI, TliI
    PaeR7IR0177C/TCGAG
    TliIR0612C/TCGAG
    XhoIIR/GATCYBstYIR0523R/GATCYBstX2I, BstYI, MflI, PsuI
    XmaCIC/CCGGGSmaI^R0141CCC/GGGCfr9I, PspAI , SmaI^, TspMI
    TspMIR0709C/CCGGG
    XmaIC/CCGGGXmaIR0180C/CCGGGCfr9I, PspAI , SmaI^, TspMI, XmaCI
    TspMIR0709C/CCGGG
    XmaIIIxC/GGCCGEagIR0505C/GGCCGBseX3I , BstZI, EagI, EclXI, Eco52I
    XmaJIC/CTAGGAvrIIR0174C/CTAGGAspA2I , AvrII, BlnI , BspA2I
    XmiIGT/MKACAccIR0161GT/MKACAccI, FblI
    XmnIGAANN/NNTTCXmnIR0194GAANN/NNTTCAsp700I , MroXI, PdmI
    XspIC/TAGBfaIR0568C/TAGBfaI, FspBI, MaeI
    ZhoIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI
    ClaIR0197AT/CGAT
    ZraIGAC/GTCZraIR0659GAC/GTCAatII^
    AatII^R0117GACGT/C
    ZrmIAGT/ACTScaIR0122AGT/ACTAcc113I , AssI , BmcAI^, ScaI
    Zsp2IATGCA/TNsiIR0127ATGCA/TAvaIII ^, BfrBl, EcoT22I, Mph1103I, NsiI

    Restriction endonucleases that recognize the same sequence are isoschizomers. The first example discovered is called a prototype and all subsequent enzymes that recognize the same sequence are isoschizomers of the prototype. The list below contains isoschizomers for commercially available restriction endonucleases. It also specifies which isoschizomer is available from New England Biolabs.

    All recognition sequences are written 5´ to 3´ using the single letter code nomenclature with the point of cleavage indicated by a "/".

    Numbers in parentheses indicate point of cleavage for non-palindromic enzymes. For example, GGTCTC(1/5) indicates cleavage at:
    5´ ...GGTCTCN/...3´
    3´ ...CCAGAGNNNNN/...5´

    Isoschizomers with alternative cleavage sites are indicated with a " ^ ". Enzymes that are not currently commercially available are indicated with a " x ".

    Neoschizomers are a subset of isoschizomers that recognize the same sequence, but cleave at different positions from the prototype. Thus, AatII (recognition sequence: GACGT↓C) and ZraI (recognition sequence: GAC↓GTC) are neoschizomers of one another, while HpaII (recognition sequence: C↓CGG) and MspI (recognition sequence: C↓CGG) are isoschizomers. Analogous designations are not appropriate for MTases, where the differences between enzymes are not so easily defined and usually have not been well characterized.