Dam-Dcm and CpG Methylation

DNA methyltransferases (MTases) that transfer a methyl group from S-adenosylmethionine to either adenine or cytosine residues, are found in a wide variety of prokaryotes and eukaryotes. Methylation should be considered when digesting DNA with restriction endonucleases because cleavage can be blocked or impaired when a particular base in the recognition site is methylated.

Prokaryotic Methylation

In prokaryotes, MTases have most often been identified as elements of restriction/modification systems that act to protect host DNA from cleavage by the corresponding restriction endonuclease. Most laboratory strains of E. coli contain three site-specific DNA methylases.

  • Dam methylase–methylation at the N6 position of the adenine in the sequence GATC (1,2).
  • Dcm methyltransferases–methylation at the C5 position of the second cytosine in the sequences CCAGG and CCTGG (1,3).
  • EcoKI methylase–methylation of adenine in the sequences AAC(N6)GTGC and GCAC(N6)GTT.

Some or all of the sites for a restriction endonuclease may be resistant to cleavage when isolated from strains expressing the Dam or Dcm methylases if the methylase recognition site overlaps the endonuclease recognition site. For example, plasmid DNA isolated from dam+ E. coli is completely resistant to cleavage by MboI, which cleaves at GATC sites.

Not all DNA isolated from E. coli is methylated to the same extent. While pBR322 DNA is fully modified (and is therefore completely resistant to MboI digestion), only about 50% of λ DNA Dam sites are methylated, presumably because the methylase does not have the opportunity to methylate the DNA fully before it is packaged into the phage head. As a result, enzymes blocked by Dam or Dcm modification will yield partial digestion patterns with λ DNA.

Restriction sites that are blocked by Dam or Dcm methylation can be un-methylated by cloning your DNA into a dam, dcm strain of E. coli, such as dam/dcm Competent E. coli (NEB #C2925).

Restriction sites can also be blocked if an overlapping site is present. In this case, part of the Dam or Dcm sequence is generated by the restriction enzyme sequence, followed by the flanking sequence. This situation should also be considered when designing restriction enzyme digests.

Eukaryotic Methylation

CpG MTases, found in higher eukaryotes (e.g., Dnmt1), transfer a methyl group to the C5 position of cytosine residues. Patterns of CpG methylation are heritable, tissue specific and correlate with gene expression. Consequently, CpG methylation has been postulated to play a role in differentiation and gene expression (4).

Note: The effects of CpG methylation are mainly a concern when digesting eukaryotic genomic DNA. CpG methylation patterns are not retained once the DNA is cloned into a bacterial host.

Methylation Sensitivity

The table below summarizes methylation sensitivity for NEB restriction enzymes, indicating whether or not cleavage is blocked or impaired by Dam, Dcm or CpG methylation if or when it overlaps each recognition site. This table should be viewed as a guide to the behavior of the enzymes listed rather than an absolute indicator. Consult REBASE , the restriction enzyme database, for more detailed information and specific examples upon which these guidelines are based.

References

  1. Marinus, M.G. and Morris, N.R. (1973) J. Bacteriol. 114, 1143–1150. PMID: 4576399
  2. Geier, G.E.and Modrich, P. (1979) J. Biol. Chem. 254, 1408–1413. PMID: 368070
  3. May, M.S. and Hattman, S.(1975) J. Bacteriol. 123, 768–770. PMID: 1097428
  4. Siegfried, Z. and Cedar, H. (1997) Curr. Biol. 7, r305–307. PMID: 9115385

Legend

Not Sensitive Impaired
Blocked ◇ ol Impaired by Overlapping
◻ ol Blocked by Overlapping ◇ scol Impaired by Some Combinations of Overlapping
◻ scol Blocked by Some Combinations of Overlapping
Single Letter Code
Enzyme Sequence Dam Dcm Cpg
AatII GACGT/C
AbaSI CNNNNNNNNNNN/NNNNNNNNNG
Acc65I G/GTACC ◻ scol ◻ scol
AccI GT/MKAC ◻ ol
AciI CCGC(-3/-1)
AclI AA/CGTT
AcuI CTGAAG(16/14)
AfeI AGC/GCT
AflII C/TTAAG
AflIII A/CRYGT
AgeI § A/CCGGT
AgeI-HF® A/CCGGT
AhdI GACNNN/NNGTC ◇ scol
AleI CACNN/NNGTG ◇ scol
AluI AG/CT
AlwI GGATC(4/5)
AlwNI CAGNNN/CTG ◻ ol
ApaI GGGCC/C ◻ ol ◻ ol
ApaLI G/TGCAC ◻ ol
ApeKI G/CWGC ◻ ol
Enzyme Sequence Dam Dcm CpG
ApoI § R/AATTY
ApoI-HF R/AATTY
AscI GG/CGCGCC
AseI AT/TAAT
AsiSI GCGAT/CGC
AvaI C/YCGRG
AvaII G/GWCC ◻ ol ◻ ol
AvrII C/CTAGG
BaeGI GKGCM/C
BaeI (10/15)ACNNNNGTAYC(12/7) ◻ scol
BamHI § G/GATCC
BamHI-HF® G/GATCC
BanI G/GYRCC ◻ scol ◻ scol
BanII GRGCY/C
BbsI § GAAGAC(2/6)
BbsI-HF® GAAGAC(2/6)
BbvCI CCTCAGC(-5/-2) ◇ ol
BbvI GCAGC(8/12)
BccI CCATC(4/5)
Enzyme Sequence Dam Dcm CpG
BceAI ACGGC(12/14)
BcgI (10/12)CGANNNNNNTGC(12/10) ◇ ol ◻ scol
BciVI GTATCC(6/5)
BclI § T/GATCA
BclI-HF T/GATCA
BcoDI GTCTC(1/5) ◇ scol
BfaI C/TAG
BfuAI ACCTGC(4/8) ◇ ol
BglI GCCNNNN/NGGC ◻ scol
BglII A/GATCT
BlpI GC/TNAGC
BmgBI CACGTC(-3/-3)
BmrI ACTGGG(5/4)
BmtI § GCTAG/C
BmtI-HF® GCTAG/C
BpmI CTGGAG(16/14)
BpuEI CTTGAG(16/14)
Bpu10I CCTNAGC(-5/-2)
BsaAI YAC/GTR
Enzyme Sequence Dam Dcm CpG
BsaBI GATNN/NNATC ◻ ol ◻ scol
BsaHI GR/CGYC ◻ scol
BsaI § GGTCTC(1/5) ◇ scol ◻ scol
BsaI-HF®v2 GGTCTC(1/5) ◇ scol ◻ scol
BsaJI C/CNNGG
BsaWI W/CCGGW
BsaXI (9/12)ACNNNNNCTCC(10/7)
BseRI GAGGAG(10/8)
BseYI CCCAGC(-5/-1) ◻ ol
BsgI GTGCAG(16/14)
BsiEI CGRY/CG
BsiHKAI GWGCW/C
BsiWI § C/GTACG
BsiWI-HF® C/GTACG
BslI CCNNNNN/NNGG ◻ scol ◻ scol
BsmAI GTCTC(1/5) ◻ scol
BsmBI CGTCTC(1/5)
BsmFI GGGAC(10/14) ◻ ol ◻ ol
BsmI GAATGC(1/-1)
Enzyme Sequence Dam Dcm CpG
BsoBI C/YCGRG
BspCNI CTCAG(9/7)
BspDI AT/CGAT ◻ ol
BspEI T/CCGGA ◻ ol
BspHI T/CATGA ◇ ol
Bsp1286I GDGCH/C
BspMI ACCTGC(4/8)
BspQI GCTCTTC(1/4)
BsrBI CCGCTC(-3/-3) ◻ scol
BsrDI GCAATG(2/0)
BsrFαI R/CCGGY
BsrGI § T/GTACA
BsrGI-HF® T/GTACA
BsrI ACTGG(1/-1)
BssHII G/CGCGC
BssSαI CACGAG(-5/-1)
BstAPI GCANNNN/NTGC ◻ scol
BstBI TT/CGAA
BstEII  § G/GTNACC
Enzyme Sequence Dam Dcm CpG
BstEII-HF® G/GTNACC
BstNI CC/WGG
BstUI CG/CG
BstXI CCANNNNN/NTGG ◻ scol
BstYI R/GATCY
BstZ17I-HF® GTATAC ◻ scol
Bsu36I CC/TNAGG
BtgI C/CRYGG
BtgZI GCGATG(10/14)
BtsαI GCAGTG(2/0)
BtsCI GGATG(2/0)
BtsIMutI CAGTG(2/0)
Cac8I GCN/NGC ◻ scol
ClaI AT/CGAT ◻ ol
CspCI (11/13)CAANNNNNGTGG(12/10)
CviAII C/ATG
CviKI-1 RG/CY
CviQI G/TAC
DdeI C/TNAG
Enzyme Sequence Dam Dcm CpG
DpnI GA/TC ◻ ol
DpnII /GATC
DraI TTT/AAA
DraIII-HF® CACNNN/GTG ◇ ol
DrdI GACNNNN/NNGTC ◻ scol
EaeI Y/GGCCR ◻ ol ◻ ol
EagI § C/GGCCG
EagI-HF® C/GGCCG
EarI CTCTTC(1/4) ◇ ol
EciI GGCGGA(11/9) ◻ scol
Eco53kI GAG/CTC ◻ scol
EcoNI CCTNN/NNNAGG
EcoO109I RG/GNCCY ◻ ol
EcoP15I CAGCAG(25/27)
EcoRI § G/AATTC ◻ scol
EcoRI-HF® G/AATTC ◻ scol
EcoRV § GAT/ATC ◇ scol
EcoRV-HF® GAT/ATC ◇ scol
Esp3I CGTCTC(1/5)
Enzyme Sequence Dam Dcm CpG
FatI /CATG
FauI CCCGC(4/6)
Fnu4HI GC/NGC ◻ ol
FokI GGATG(9/13) ◇ ol ◇ ol
FseI GGCCGG/CC ◇ scol
FspEI CC(12/16)
FspI TGC/GCA
HaeII RGCGC/Y
HaeIII GG/CC
HgaI GACGC(5/10)
HhaI GCG/C
HincII GTY/RAC ◻ scol
HindIII § A/AGCTT
HindIII-HF® A/AGCTT
HinfI G/ANTC ◻ scol
HinP1I G/CGC
HpaI GTT/AAC ◻ scol
HpaII C/CGG
HphI GGTGA(8/7)
Enzyme Sequence Dam Dcm CpG
HpyAV CCTTC(6/5) ◇ ol
HpyCH4III ACN/GT
HpyCH4IV A/CGT
HpyCH4V TG/CA
Hpy188I TCN/GA ◻ ol
Hpy99I CGWCG/
Hpy166II GTN/NAC ◻ ol
Hpy188III TC/NNGA ◻ ol ◻ ol
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceI TAGGGATAACAGGGTAAT(-9/-13)
KasI G/GCGCC
KpnI § GGTAC/C
KpnI-HF® GGTAC/C
LpnPI CCDG(10/14)
MboI /GATC ◇ ol
MboII GAAGA(8/7) ◻ ol
MfeI § C/AATTG
MfeI-HF® C/AATTG
MluCI /AATT
Enzyme Sequence Dam Dcm CpG
MluI § A/CGCGT
MluI-HF® A/CGCGT
MlyI GAGTC(5/5)
MmeI TCCRAC(20/18) ◻ ol
MnlI CCTC(7/6)
MscI TGG/CCA ◻ ol
MseI T/TAA
MslI CAYNN/NNRTG
MspA1I CMG/CKG ◻ ol
MspI C/CGG
MspJI CNNR(9/13)
MwoI GCNNNNN/NNGC ◻ scol
NaeI GCC/GGC
NarI GG/CGCC
Nb.BbvCI CCTCAGC
Nb.BsmI GAATGC
Nb.BsrDI GCAATG
Nb.BssSI CACGAG
Nb.BtsI GCAGTG
Enzyme Sequence Dam Dcm CpG
NciI CC/SGG ◇ ol
NcoI § C/CATGG
NcoI-HF® C/CATGG
NdeI CA/TATG
NgoMIV G/CCGGC
NheI § G/CTAGC ◻ scol
NheI-HF® G/CTAGC ◻ scol
NlaIII CATG/
NlaIV GGN/NCC ◻ ol ◻ ol
NmeAIII GCCGAG(21/19)
NotI § GC/GGCCGC
NotI-HF® GC/GGCCGC
NruI § TCG/CGA ◻ ol
NruI-HF® TCG/CGA ◻ ol
NsiI § ATGCA/T
NsiI-HF® ATGCA/T
NspI RCATG/Y
Nt.AlwI GGATC(4/-5)
Nt.BbvCI CCTCAGC(-5/-7) ◻ scol
Enzyme Sequence Dam Dcm CpG
Nt.BsmAI GTCTC(1/-5)
Nt.BspQI GCTCTTC(1/-7)
Nt.BstNBI GAGTC(4/-5)
Nt.CviPII (0/-1)CCD
PacI TTAAT/TAA
PaeR7I C/TCGAG
PciI A/CATGT
PflFI GACN/NNGTC
PflMI CCANNNN/NTGG ◻ ol
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
PleI GAGTC(4/5) ◻ scol
PluTI GGCGC/C
PmeI GTTT/AAAC ◻ scol
PmlI CAC/GTG
PpuMI RG/GWCCY ◻ ol
PshAI GACNN/NNGTC ◻ scol
PsiI TTA/TAA
PspGI /CCWGG
Enzyme Sequence Dam Dcm CpG
PspOMI G/GGCCC ◇ scol ◻ ol
PspXI VC/TCGAGB
PstI § CTGCA/G
PstI-HF® CTGCA/G
PvuI § CGAT/CG
PvuI-HF® CGAT/CG
PvuII § CAG/CTG
PvuII-HF® CAG/CTG
RsaI GT/AC ◻ scol
RsrII CG/GWCCG
SacI § GAGCT/C
SacI-HF® GAGCT/C ◻ scol
SacII CCGC/GG
SalI § G/TCGAC
SalI-HF® G/TCGAC
SapI GCTCTTC(1/4)
Sau3AI /GATC ◻ ol
Sau96I G/GNCC ◻ ol ◻ ol
SbfI § CCTGCA/GG
Enzyme Sequence Dam Dcm CpG
SbfI-HF® CCTGCA/GG
ScaI-HF® AGT/ACT
ScrFI CC/NGG ◻ ol ◻ ol
SexAI A/CCWGGT
SfaNI GCATC(5/9) ◇ scol
SfcI C/TRYAG
SfiI GGCCNNNN/NGGCC ◇ ol ◻ scol
SfoI GGC/GCC ◻ scol
SgrAI CR/CCGGYG
SmaI CCC/GGG
SmlI C/TYRAG
SnaBI TAC/GTA
SpeI § A/CTAGT
SpeI-HF® A/CTAGT
SphI § GCATG/C
SphI-HF® GCATG/C
SrfI GCCC/GGGC
SspI § AAT/ATT
SspI-HF® AAT/ATT
Enzyme Sequence Dam Dcm CpG
StuI AGG/CCT ◻ ol
StyD4I /CCNGG ◻ ol ◇ ol
StyI § C/CWWGG
StyI-HF® C/CWWGG
SwaI ATTT/AAAT
TaqαI T/CGA ◻ ol
TfiI G/AWTC ◻ scol
TseI G/CWGC ◻ scol
Tsp45I /GTSAC
TspMI C/CCGGG
TspRI NNCASTGNN/
Tth111I GACN/NNGTC
XbaI T/CTAGA ◻ ol
XcmI CCANNNNN/NNNNTGG
XhoI C/TCGAG
XmaI C/CCGGG
XmnI GAANN/NNTTC
ZraI GAC/GTC
§ An HF version of this enzyme is available.
Loading Spinner