Dam-Dcm and CpG Methylation

DNA methyltransferases (MTases) that transfer a methyl group from S-adenosylmethionine to either adenine or cytosine residues, are found in a wide variety of prokaryotes and eukaryotes. Methylation should be considered when digesting DNA with restriction endonucleases because cleavage can be blocked or impaired when a particular base in the recognition site is methylated.

Prokaryotic Methylation

In prokaryotes, MTases have most often been identified as elements of restriction/modification systems that act to protect host DNA from cleavage by the corresponding restriction endonuclease. Most laboratory strains of E. coli contain three site-specific DNA methylases.

  • Dam methylase–methylation at the N6 position of the adenine in the sequence GATC (1,2).
  • Dcm methyltransferases–methylation at the C5 position of the second cytosine in the sequences CCAGG and CCTGG (1,3).
  • EcoKI methylase–methylation of adenine in the sequences AAC(N6)GTGC and GCAC(N6)GTT.

Some or all of the sites for a restriction endonuclease may be resistant to cleavage when isolated from strains expressing the Dam or Dcm methylases if the methylase recognition site overlaps the endonuclease recognition site. For example, plasmid DNA isolated from dam+ E. coli is completely resistant to cleavage by MboI, which cleaves at GATC sites.

Not all DNA isolated from E. coli is methylated to the same extent. While pBR322 DNA is fully modified (and is therefore completely resistant to MboI digestion), only about 50% of λ DNA Dam sites are methylated, presumably because the methylase does not have the opportunity to methylate the DNA fully before it is packaged into the phage head. As a result, enzymes blocked by Dam or Dcm modification will yield partial digestion patterns with λ DNA.

Restriction sites that are blocked by Dam or Dcm methylation can be un-methylated by cloning your DNA into a dam, dcm strain of E. coli, such as dam/dcm Competent E. coli (NEB #C2925).

Restriction sites can also be blocked if an overlapping site is present. In this case, part of the Dam or Dcm sequence is generated by the restriction enzyme sequence, followed by the flanking sequence. This situation should also be considered when designing restriction enzyme digests.

Eukaryotic Methylation

CpG MTases, found in higher eukaryotes (e.g., Dnmt1), transfer a methyl group to the C5 position of cytosine residues. Patterns of CpG methylation are heritable, tissue specific and correlate with gene expression. Consequently, CpG methylation has been postulated to play a role in differentiation and gene expression (4).

Note: The effects of CpG methylation are mainly a concern when digesting eukaryotic genomic DNA. CpG methylation patterns are not retained once the DNA is cloned into a bacterial host.

Methylation Sensitivity

The table below summarizes methylation sensitivity for NEB restriction enzymes, indicating whether or not cleavage is blocked or impaired by Dam, Dcm or CpG methylation if or when it overlaps each recognition site. This table should be viewed as a guide to the behavior of the enzymes listed rather than an absolute indicator. Consult REBASE , the restriction enzyme database, for more detailed information and specific examples upon which these guidelines are based.

References

  1. Marinus, M.G. and Morris, N.R. (1973) J. Bacteriol. 114, 1143–1150. PMID: 4576399
  2. Geier, G.E.and Modrich, P. (1979) J. Biol. Chem. 254, 1408–1413. PMID: 368070
  3. May, M.S. and Hattman, S.(1975) J. Bacteriol. 123, 768–770. PMID: 1097428
  4. Siegfried, Z. and Cedar, H. (1997) Curr. Biol. 7, r305–307. PMID: 9115385

Legend

Not Sensitive   Impaired
Blocked Impaired by Overlapping
Blocked by Overlapping Impaired by Some Combinations of Overlapping
Blocked by Some Combinations of Overlapping
Single Letter Code
Enzyme Sequence Dam Dcm Cpg
AatII GACGT/C not sensitive not sensitive blocked
AbaSI not sensitive not sensitive not sensitive
AccI GT/MKAC not sensitive not sensitive Blocked by Overlapping
Acc65I G/GTACC not sensitive Blocked by Some Combinations of Overlapping Blocked by Some Combinations of Overlapping
AciI CCGC(-3/-1) not sensitive not sensitive blocked
AclI AA/CGTT not sensitive not sensitive blocked
AcuI CTGAAG(16/14)
AfeI AGC/GCT
AflII C/TTAAG not sensitive not sensitive not sensitive
AflIII A/CRYGT not sensitive not sensitive not sensitive
AgeI § A/CCGGT not sensitive not sensitive blocked
AgeI-HF® A/CCGGT not sensitive not sensitive blocked
AhdI GACNNN/NNGTC not sensitive not sensitive Impaired by Some Combinations of Overlapping
AleI CACNN/NNGTG not sensitive not sensitive Impaired by Some Combinations of Overlapping
AluI AG/CT not sensitive not sensitive not sensitive
AlwI GGATC(4/5) blocked not sensitive not sensitive
AlwNI CAGNNN/CTG not sensitive Blocked by Overlapping not sensitive
ApaI GGGCC/C not sensitive Blocked by Overlapping Blocked by Overlapping
ApaLI G/TGCAC not sensitive not sensitive Blocked by Overlapping
ApeKI G/CWGC not sensitive not sensitive Blocked by Overlapping
Enzyme Sequence Dam Dcm CpG
ApoI § R/AATTY not sensitive not sensitive not sensitive
ApoI-HF R/AATTY not sensitive not sensitive not sensitive
AscI GG/CGCGCC not sensitive not sensitive blocked
AseI AT/TAAT not sensitive not sensitive not sensitive
AsiSI GCGAT/CGC not sensitive not sensitive blocked
AvaI C/YCGRG not sensitive not sensitive blocked
AvaII G/GWCC not sensitive Blocked by Overlapping Blocked by Overlapping
AvrII C/CTAGG not sensitive not sensitive not sensitive
Enzyme Back to top Sequence Dam Dcm CpG
BaeGI GKGCM/C not sensitive not sensitive not sensitive
BaeI (10/15)ACNNNNGTAYC(12/7) not sensitive not sensitive Blocked by Some Combinations of Overlapping
BamHI § G/GATCC not sensitive not sensitive not sensitive
BamHI-HF® G/GATCC not sensitive not sensitive not sensitive
BanI G/GYRCC not sensitive Blocked by Some Combinations of Overlapping Blocked by Some Combinations of Overlapping
BanII GRGCY/C not sensitive not sensitive not sensitive
BbsI § GAAGAC(2/6) not sensitive not sensitive not sensitive
BbsI-HF® GAAGAC(2/6) not sensitive not sensitive not sensitive
BbvCI CCTCAGC(-5/-2) not sensitive not sensitive Impaired by Overlapping
BbvI GCAGC(8/12)
BccI CCATC(4/5) not sensitive not sensitive not sensitive
Enzyme Sequence Dam Dcm CpG
BceAI ACGGC(12/14) not sensitive not sensitive blocked
BcgI (10/12)CGANNNNNNTGC(12/10)
BciVI GTATCC(6/5) not sensitive not sensitive not sensitive
BclI T/GATCA blocked not sensitive not sensitive
BclI-HF T/GATCA blocked not sensitive not sensitive
BcoDI GTCTC(1/5) not sensitive not sensitive Impaired by Some Combinations of Overlapping
BfaI C/TAG not sensitive not sensitive not sensitive
BfuAI ACCTGC(4/8) not sensitive not sensitive Impaired by Overlapping
BfuCI /GATC not sensitive not sensitive Blocked by Overlapping
BglI GCCNNNN/NGGC not sensitive not sensitive Blocked by Some Combinations of Overlapping
BglII A/GATCT not sensitive not sensitive not sensitive
BlpI GC/TNAGC not sensitive not sensitive not sensitive
BmgBI CACGTC(-3/-3)
BmrI ACTGGG(5/4) not sensitive not sensitive not sensitive
BmtI § GCTAG/C not sensitive not sensitive not sensitive
BmtI-HF® GCTAG/C not sensitive not sensitive not sensitive
BpmI CTGGAG(16/14) not sensitive not sensitive not sensitive
BpuEI CTTGAG(16/14) not sensitive not sensitive not sensitive
Bpu10I CCTNAGC(-5/-2) not sensitive not sensitive not sensitive
Enzyme Sequence Dam Dcm CpG
BsaAI YAC/GTR not sensitive not sensitive blocked
BsaBI GATNN/NNATC Blocked by Overlapping not sensitive Blocked by Some Combinations of Overlapping
BsaHI GR/CGYC not sensitive Blocked by Some Combinations of Overlapping blocked
BsaI § GGTCTC(1/5) not sensitive Impaired by Some Combinations of Overlapping Blocked by Some Combinations of Overlapping
BsaI-HF® GGTCTC(1/5) not sensitive Blocked by Overlapping Blocked by Some Combinations of Overlapping
BsaJI C/CNNGG not sensitive not sensitive not sensitive
BsaWI W/CCGGW not sensitive not sensitive not sensitive
BsaXI (9/12)ACNNNNNCTCC(10/7) not sensitive not sensitive not sensitive
BseRI GAGGAG(10/8) not sensitive not sensitive not sensitive
BseYI CCCAGC(-5/-1) not sensitive not sensitive Blocked by Overlapping
BsgI GTGCAG(16/14) not sensitive not sensitive not sensitive
BsiEI CGRY/CG not sensitive not sensitive blocked
BsiHKAI GWGCW/C not sensitive not sensitive not sensitive
BsiWI § C/GTACG not sensitive not sensitive blocked
BsiWI-HF® C/GTACG not sensitive not sensitive blocked
BslI CCNNNNN/NNGG not sensitive Blocked by Some Combinations of Overlapping Blocked by Some Combinations of Overlapping
BsmAI GTCTC(1/5) not sensitive not sensitive Blocked by Some Combinations of Overlapping
BsmBI CGTCTC(1/5) not sensitive not sensitive blocked
BsmFI GGGAC(10/14) not sensitive Blocked by Overlapping Blocked by Overlapping
Enzyme Sequence Dam Dcm CpG
BsmI GAATGC(1/-1) not sensitive not sensitive not sensitive
BsoBI C/YCGRG not sensitive not sensitive not sensitive
BspCNI CTCAG(9/7) not sensitive not sensitive not sensitive
BspDI AT/CGAT Blocked by Overlapping not sensitive blocked
BspEI T/CCGGA Blocked by Overlapping not sensitive Impaired
BspHI T/CATGA Impaired by Overlapping not sensitive not sensitive
Bsp1286I GDGCH/C not sensitive not sensitive not sensitive
BspMI ACCTGC(4/8) not sensitive not sensitive not sensitive
BspQI GCTCTTC(1/4) not sensitive not sensitive not sensitive
BsrBI CCGCTC(-3/-3) not sensitive not sensitive Blocked by Some Combinations of Overlapping
BsrDI GCAATG(2/0) not sensitive not sensitive not sensitive
BsrFαI R/CCGGY not sensitive not sensitive blocked
BsrGI § T/GTACA not sensitive not sensitive not sensitive
BsrGI-HF® T/GTACA not sensitive not sensitive not sensitive
BsrI ACTGG(1/-1) not sensitive not sensitive not sensitive
BssHII G/CGCGC not sensitive not sensitive blocked
BssSαI CACGAG(-5/-1) not sensitive not sensitive not sensitive
BstAPI GCANNNN/NTGC not sensitive not sensitive Blocked by Some Combinations of Overlapping
BstBI TT/CGAA not sensitive not sensitive blocked
Enzyme Sequence Dam Dcm CpG
BstEII  § G/GTNACC not sensitive not sensitive not sensitive
BstEII-HF® G/GTNACC not sensitive not sensitive not sensitive
BstNI CC/WGG not sensitive not sensitive not sensitive
BstUI CG/CG not sensitive not sensitive blocked
BstXI CCANNNNN/NTGG not sensitive Blocked by Some Combinations of Overlapping not sensitive
BstYI R/GATCY not sensitive not sensitive not sensitive
BstZ17I-HF® GTATAC not sensitive not sensitive Blocked by Some Combinations of Overlapping
Bsu36I CC/TNAGG not sensitive not sensitive not sensitive
BtgI C/CRYGG not sensitive not sensitive not sensitive
BtgZI GCGATG(10/14) not sensitive not sensitive Impaired
BtsαI GCAGTG(2/0) not sensitive not sensitive not sensitive
BtsCI GGATG(2/0) not sensitive not sensitive not sensitive
BtsIMutI CAGTG(2/0) not sensitive not sensitive not sensitive
Enzyme Back to top Sequence Dam Dcm CpG
Cac8I GCN/NGC not sensitive not sensitive Blocked by Some Combinations of Overlapping
ClaI AT/CGAT Blocked by Overlapping not sensitive blocked
CspCI (11/13)CAANNNNNGTGG(12/10)
CviAII C/ATG not sensitive not sensitive not sensitive
CviKI-1 RG/CY not sensitive not sensitive not sensitive
CviQI G/TAC not sensitive not sensitive not sensitive
Enzyme Sequence Dam Dcm CpG
Enzyme Back to top Sequence Dam Dcm CpG
DdeI C/TNAG not sensitive not sensitive not sensitive
DpnI GA/TC not sensitive not sensitive Blocked by Overlapping
DpnII /GATC
DraI TTT/AAA not sensitive not sensitive not sensitive
DraIII-HF® CACNNN/GTG not sensitive not sensitive Impaired by Overlapping
DrdI GACNNNN/NNGTC not sensitive not sensitive Blocked by Some Combinations of Overlapping
Enzyme Back to top Sequence Dam Dcm CpG
EaeI Y/GGCCR not sensitive Blocked by Overlapping Blocked by Overlapping
EagI § C/GGCCG not sensitive not sensitive blocked
EagI-HF® C/GGCCG not sensitive not sensitive blocked
EarI CTCTTC(1/4) not sensitive not sensitive Impaired by Overlapping
EciI GGCGGA(11/9) not sensitive not sensitive Blocked by Some Combinations of Overlapping
Eco53kI GAG/CTC not sensitive not sensitive Blocked by Some Combinations of Overlapping
EcoNI CCTNN/NNNAGG not sensitive not sensitive not sensitive
EcoO109I RG/GNCCY
EcoP15I CAGCAG(25/27) not sensitive not sensitive not sensitive
EcoRI § G/AATTC not sensitive not sensitive Blocked by Some Combinations of Overlapping
EcoRI-HF® G/AATTC not sensitive not sensitive Blocked by Some Combinations of Overlapping
EcoRV § GAT/ATC not sensitive not sensitive Impaired by Some Combinations of Overlapping
EcoRV-HF® GAT/ATC not sensitive not sensitive Impaired by Some Combinations of Overlapping
Enzyme Sequence Dam Dcm CpG
Enzyme Back to top Sequence Dam Dcm CpG
FatI /CATG not sensitive not sensitive not sensitive
FauI CCCGC(4/6) not sensitive not sensitive blocked
Fnu4HI GC/NGC not sensitive not sensitive Blocked by Overlapping
FokI GGATG(9/13) not sensitive Impaired by Overlapping Impaired by Overlapping
FseI GGCCGG/CC not sensitive Impaired by Some Combinations of Overlapping blocked
FspEI CC(12/16) not sensitive not sensitive not sensitive
FspI TGC/GCA not sensitive not sensitive blocked
Enzyme Back to top Sequence Dam Dcm CpG
HaeII RGCGC/Y not sensitive not sensitive blocked
HaeIII GG/CC not sensitive not sensitive not sensitive
HgaI GACGC(5/10) not sensitive not sensitive blocked
HhaI GCG/C not sensitive not sensitive blocked
HincII GTY/RAC not sensitive not sensitive Blocked by Some Combinations of Overlapping
HindIII § A/AGCTT not sensitive not sensitive not sensitive
HindIII-HF® A/AGCTT not sensitive not sensitive not sensitive
HinfI G/ANTC not sensitive not sensitive Blocked by Some Combinations of Overlapping
HinP1I G/CGC not sensitive not sensitive blocked
HpaI GTT/AAC not sensitive not sensitive Blocked by Some Combinations of Overlapping
HpaII C/CGG not sensitive not sensitive blocked
HphI GGTGA(8/7) blocked blocked not sensitive
Enzyme Sequence Dam Dcm CpG
HpyAV CCTTC(6/5) not sensitive not sensitive Impaired by Overlapping
HpyCH4III ACN/GT not sensitive not sensitive not sensitive
HpyCH4IV A/CGT not sensitive not sensitive blocked
HpyCH4V TG/CA not sensitive not sensitive not sensitive
Hpy188I TCN/GA Blocked by Overlapping not sensitive not sensitive
Hpy99I CGWCG/ not sensitive not sensitive blocked
Hpy166II GTN/NAC not sensitive not sensitive Blocked by Overlapping
Hpy188III TC/NNGA Blocked by Overlapping not sensitive Blocked by Overlapping
Enzyme Back to top Sequence Dam Dcm CpG
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceI TAGGGATAACAGGGTAAT(-9/-13)
Enzyme Back to top Sequence Dam Dcm CpG
KasI G/GCGCC not sensitive not sensitive blocked
KpnI § GGTAC/C not sensitive not sensitive not sensitive
KpnI-HF® GGTAC/C
Enzyme Back to top Sequence Dam Dcm CpG
LpnPI CCDG(10/14) not sensitive not sensitive not sensitive
Enzyme Back to top Sequence Dam Dcm CpG
MboI /GATC blocked not sensitive Impaired by Overlapping
MboII GAAGA(8/7) Blocked by Overlapping not sensitive not sensitive
MfeI § C/AATTG
MfeI-HF® C/AATTG not sensitive not sensitive not sensitive
MluCI /AATT not sensitive not sensitive not sensitive
Enzyme Sequence Dam Dcm CpG
MluI § A/CGCGT not sensitive not sensitive blocked
MluI-HF® A/CGCGT not sensitive not sensitive blocked
MlyI GAGTC(5/5) not sensitive not sensitive not sensitive
MmeI TCCRAC(20/18) not sensitive not sensitive Blocked by Overlapping
MnlI CCTC(7/6) not sensitive not sensitive not sensitive
MscI TGG/CCA not sensitive Blocked by Overlapping not sensitive
MseI T/TAA not sensitive not sensitive not sensitive
MslI CAYNN/NNRTG not sensitive not sensitive not sensitive
MspA1I CMG/CKG not sensitive not sensitive Blocked by Overlapping
MspI C/CGG not sensitive not sensitive not sensitive
MspJI CNNR(9/13) not sensitive not sensitive not sensitive
MwoI GCNNNNN/NNGC not sensitive not sensitive Blocked by Some Combinations of Overlapping
Enzyme Back to top Sequence Dam Dcm CpG
NaeI GCC/GGC not sensitive not sensitive blocked
NarI GG/CGCC not sensitive not sensitive blocked
Nb.BbvCI CCTCAGC not sensitive not sensitive not sensitive
Nb.BsmI GAATGC not sensitive not sensitive not sensitive
Nb.BsrDI GCAATG not sensitive not sensitive not sensitive
Nb.BssSI CACGAG
Nb.BtsI GCAGTG not sensitive not sensitive not sensitive
Enzyme Sequence Dam Dcm CpG
NciI CC/SGG not sensitive not sensitive Impaired by Overlapping
NcoI § C/CATGG not sensitive not sensitive not sensitive
NcoI-HF® C/CATGG not sensitive not sensitive not sensitive
NdeI CA/TATG not sensitive not sensitive not sensitive
NgoMIV G/CCGGC not sensitive not sensitive blocked
NheI § G/CTAGC not sensitive not sensitive Blocked by Some Combinations of Overlapping
NheI-HF® G/CTAGC not sensitive not sensitive Blocked by Some Combinations of Overlapping
NlaIII CATG/ not sensitive not sensitive not sensitive
NlaIV GGN/NCC not sensitive Blocked by Overlapping Blocked by Overlapping
NmeAIII GCCGAG(21/19) not sensitive not sensitive not sensitive
NotI § GC/GGCCGC not sensitive not sensitive blocked
NotI-HF® GC/GGCCGC not sensitive not sensitive blocked
NruI § TCG/CGA Blocked by Overlapping not sensitive blocked
NruI-HF® TCG/CGA Blocked by Overlapping not sensitive blocked
NsiI § ATGCA/T not sensitive not sensitive not sensitive
NsiI-HF® ATGCA/T not sensitive not sensitive not sensitive
NspI RCATG/Y not sensitive not sensitive not sensitive
Nt.AlwI GGATC(4/-5) blocked not sensitive not sensitive
Nt.BbvCI CCTCAGC(-5/-7) not sensitive not sensitive Blocked by Some Combinations of Overlapping
Enzyme Sequence Dam Dcm CpG
Nt.BsmAI GTCTC(1/-5) not sensitive not sensitive blocked
Nt.BspQI GCTCTTC(1/-7) not sensitive not sensitive not sensitive
Nt.BstNBI GAGTC(4/-5) not sensitive not sensitive not sensitive
Enzyme Back to top Sequence Dam Dcm CpG
PacI TTAAT/TAA not sensitive not sensitive not sensitive
PaeR7I C/TCGAG not sensitive not sensitive blocked
PciI A/CATGT
PflFI GACN/NNGTC
PflMI CCANNNN/NTGG not sensitive Blocked by Overlapping not sensitive
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
PleI GAGTC(4/5) not sensitive not sensitive Blocked by Some Combinations of Overlapping
PluTI GGCGC/C not sensitive not sensitive blocked
PmeI GTTT/AAAC not sensitive not sensitive Blocked by Some Combinations of Overlapping
PmlI CAC/GTG not sensitive not sensitive blocked
PpuMI RG/GWCCY not sensitive Blocked by Overlapping not sensitive
PshAI GACNN/NNGTC not sensitive not sensitive Blocked by Some Combinations of Overlapping
PsiI TTA/TAA
PspGI /CCWGG not sensitive blocked not sensitive
PspOMI G/GGCCC not sensitive Impaired by Some Combinations of Overlapping Blocked by Overlapping
Enzyme Sequence Dam Dcm CpG
PspXI VC/TCGAGB not sensitive not sensitive Impaired
PstI § CTGCA/G not sensitive not sensitive not sensitive
PstI-HF® CTGCA/G not sensitive not sensitive not sensitive
PvuI § CGAT/CG not sensitive not sensitive blocked
PvuI-HF® CGAT/CG not sensitive not sensitive blocked
PvuII § CAG/CTG not sensitive not sensitive not sensitive
PvuII-HF® CAG/CTG not sensitive not sensitive not sensitive
Enzyme Back to top Sequence Dam Dcm CpG
RsaI GT/AC not sensitive not sensitive Blocked by Some Combinations of Overlapping
RsrII CG/GWCCG not sensitive not sensitive blocked
Enzyme Back to top Sequence Dam Dcm CpG
SacI § GAGCT/C not sensitive not sensitive not sensitive
SacI-HF® GAGCT/C not sensitive not sensitive Blocked by Some Combinations of Overlapping
SacII CCGC/GG not sensitive not sensitive blocked
SalI § G/TCGAC not sensitive not sensitive blocked
SalI-HF® G/TCGAC
SapI GCTCTTC(1/4) not sensitive not sensitive not sensitive
Sau3AI /GATC not sensitive not sensitive Blocked by Overlapping
Sau96I G/GNCC not sensitive Blocked by Overlapping Blocked by Overlapping
SbfI § CCTGCA/GG not sensitive not sensitive not sensitive
SbfI-HF® CCTGCA/GG not sensitive not sensitive not sensitive
Enzyme Sequence Dam Dcm CpG
ScaI-HF® AGT/ACT not sensitive not sensitive not sensitive
ScrFI CC/NGG not sensitive Blocked by Overlapping Blocked by Overlapping
SexAI A/CCWGGT not sensitive blocked not sensitive
SfaNI GCATC(5/9) not sensitive not sensitive Impaired by Some Combinations of Overlapping
SfcI C/TRYAG not sensitive not sensitive not sensitive
SfiI GGCCNNNN/NGGCC not sensitive Impaired by Overlapping Blocked by Some Combinations of Overlapping
SfoI GGC/GCC not sensitive Blocked by Some Combinations of Overlapping blocked
SgrAI CR/CCGGYG not sensitive not sensitive blocked
SmaI CCC/GGG not sensitive not sensitive blocked
SmlI C/TYRAG not sensitive not sensitive not sensitive
SnaBI TAC/GTA not sensitive not sensitive blocked
SpeI § A/CTAGT not sensitive not sensitive not sensitive
SpeI-HF® A/CTAGT not sensitive not sensitive not sensitive
SphI § GCATG/C not sensitive not sensitive not sensitive
SphI-HF® GCATG/C not sensitive not sensitive not sensitive
SrfI GCCC/GGGC not sensitive not sensitive blocked
SspI § AAT/ATT not sensitive not sensitive not sensitive
SspI-HF® AAT/ATT not sensitive not sensitive not sensitive
StuI AGG/CCT not sensitive Blocked by Overlapping not sensitive
Enzyme Sequence Dam Dcm CpG
StyD4I /CCNGG not sensitive Blocked by Overlapping Impaired by Overlapping
StyI § C/CWWGG
StyI-HF® C/CWWGG not sensitive not sensitive not sensitive
SwaI ATTT/AAAT not sensitive not sensitive not sensitive
Enzyme Back to top Sequence Dam Dcm CpG
TaqαI T/CGA
TfiI G/AWTC not sensitive not sensitive Blocked by Some Combinations of Overlapping
TseI G/CWGC not sensitive not sensitive Blocked by Some Combinations of Overlapping
Tsp45I /GTSAC not sensitive not sensitive not sensitive
TspMI C/CCGGG not sensitive not sensitive blocked
TspRI NNCASTGNN/ not sensitive not sensitive not sensitive
Tth111I GACN/NNGTC not sensitive not sensitive not sensitive
Enzyme Back to top Sequence Dam Dcm CpG
XbaI T/CTAGA Blocked by Overlapping not sensitive not sensitive
XcmI CCANNNNN/NNNNTGG not sensitive not sensitive not sensitive
XhoI C/TCGAG not sensitive not sensitive Impaired
XmaI C/CCGGG not sensitive not sensitive Impaired
XmnI GAANN/NNTTC not sensitive not sensitive not sensitive
Enzyme Back to top Sequence Dam Dcm CpG
ZraI GAC/GTC not sensitive not sensitive blocked
Loading Spinner