EpiMark® 5-hmC and 5-mC Analysis Kit

The EpiMark® 5-hmC and 5-mC Analysis Kit can be used to analyze and quantitate 5-methylcytosine and 5-hydroxymethylcytosine within a specific locus. Complete conversion of 5-hmC to glucosylated 5-hmC in DNA by T4 β-glucosyltransferase (T4-BGT).

  • Discrimination between 5-mC and 5-hmC in CCGG sequences using enzymatic digestion and PCR amplification
  • Relative quantitation of 5-mC and 5-hmC
  • Easy-to-use protocol
  • This kit contains enough material for 20 reactions

Ordering Information

$name
  • 20 reactions
    $231.00
  • Product Information
    5-methylcytosine (5-mC) is the predominant epigenetic mark in mammalian genomic DNA. 5-hydroxymethylcytosine (5-hmC) is a newly discovered epigenetic modification that is presumably generated by oxidation of 5-mC by the TET family of cytosine oxygenasesrefref.

    Techniques exist that can identify 5-mC in genomic DNA, but the most commonly used method, bisulfite sequencing, is laborious and cannot distinguish between 5-mC from 5-hmCref.

    The kit distinguishes 5-mC from 5-hmC by the addition of glucose to the hydroxyl group of 5-hmC via an enzymatic reaction utilizing T4 β-glucosyltransferase (T4-BGT). When 5-hmC occurs in the context of CCGG, this modification converts a cleavable MspI site to a noncleavable one.

    An overview of the detection procedure is summarized in Figure 1.

    Control DNA Sequence 
    5´-CAGTGAAGTTGGCAGACTGAGCCAGGTCCCACAGATGCAGTGACCGGAGT
    CATTGCCAAACTCTGCAGGAGAGCAAGGGCTGTCTATAGGTGGCAAGTCA-3´

    Control DNA substrates are synthetic 100 bp double stranded fragments containing a single MspI/HpaII site (CCGG). The three fragments are identical except for modification of the internal C in this site.

    FW Primer Sequence 
    5´- CA GTG AAG TTG GCA GAC TGA GC -3´

    REV Primer Sequence 
    5´- CTG ACT TGC CAC CTA TAG ACA GC -3´

    Kit Components

    The following reagents are supplied with this product:

    Store at (°C) Concentration
    NEBuffer™ 4 -20 10 X
    T4 Phage β-glucosyltransferase (T4-BGT) -20 10,000 units/ml
    Unmodified Control DNA -20 0.1 ng/μl
    5-mC Control DNA -20 0.1 ng/μl
    5-hmC Control DNA -20 0.1 ng/μl
    Forward and Reverse Control Primer Mix -20 10 μM each
    Proteinase K, Molecular Biology Grade -20 800 mg/ml
    MspI -20 100,000 units/ml
    HpaII -20 50,000 units/ml
    Uridine Diphosphate Glucose -20 25 X
    Product Categories:
    Epigenetic Analysis (EpiMark® Validated) Products
    Applications:
    5-hmC Detection & Analysis,
    Methylated DNA Analysis
    • Properties and Usage
    • Method Overview
    • Related Products
    • References
  • FAQs & Tech Tips
  • Protocols & Manuals
  • Other Tools & Resources
  • Quality & Safety
  • Legal Information
    • Legal And Disclaimers
Loading Spinner