FAQ: How should the adaptor sequences be trimmed?

NEBNext Template Switching Oligo
GCTAATCATTGCAAG CAG TGG TAT CAA CGC AGA GTA CAT rGrGrG
 NEBNext Single Cell RT Primer  AAGCAGTGGTATCAACGCAGAGTACTTT TTT TTT TTT TTT TTT TTT TTT TTT TTT V
 NEBNext Single Cell cDNA PCR Primer  AAG CAG TGG TAT CAA CGC AGA GT

Any trimming tool can be used to trim the reads, which have these sequences on their ends.

Loading Spinner