FAQ: Do I need to change my IVT template to be able to synthesize m6A Cap-0 or m6A Cap-1 RNA?

The first base downstream of the promoter must be adenine (A).

If using T7 RNA polymerase to synthesize uncapped RNA that initiates with adenine, we recommend the T7 Promoter class II with the first three transcribed nucleotides being AGA: 5'- TAATACGACTCACTATTAGA 3'. T7 RNA polymerase starts transcription at the underlined A (+1 position) in the sequence.