Home FAQs What are the sequences needed to trim the NEBNext Low-bias Small RNA libraries?

FAQ: What are the sequences needed to trim the NEBNext Low-bias Small RNA libraries?

The following sequences can be used to trim NEBNext Low-bias Small RNA libraries:

Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Links to this resource

Related Products:: NEBNext^® Low-bias Small RNA Library Prep Kit

To Request Technical Support

Fill out our Technical Support Form,
email us, or call 1-800-632-7799.

For Questions Related to NEB Products and Offers

Contact your local US Sales Representative.

For Help With Your Order

Contact our Customer Support Team by email or call 1-800-NEB-LABS. live chat with us Monday through Friday from 9 AM to 7 PM ET.

For Customers Outside of the US

Contact your local subsidiary or distributor.

Get In Touch

Sign up and select NEB email newsletters targeted to your research

Support NEB Overview Careers Site Map Terms of Use

Trademarks Terms of Sale Privacy Cookie Policy Change Country

Choose your country

If you don't see your country above, please visit our international site

Session Expired

Your session has expired

You have been idle for more than 20 minutes, for your security you have been logged out. Please sign back in to continue your session.

Please sign in to continue shopping.

Institution Changed

Your profile has been mapped to an Institution, please sign back for your profile updates to be completed.

To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.

Don't show me again

Choose your country

North America

Europe

Asia-Pacific