Guidelines for use of Custom RNA Depletion Probe Pools with the NEBNext RNA Depletion Core Reagent Set
Design of Custom RNA Depletion Probes
DNA probes refer to ssDNA oligonucleotides used to remove unwanted RNAs from total RNA in the NEBNext RNase H-based RNA Depletion workflow. To facilitate the design of probes we have created a Custom RNA Depletion Design Tool. The input to the tool is the sequence of the unwanted/targeted RNA, 5´ to 3´ in FASTA format (Figure 1). The input sequence should only contain A, C, G or T nucleotides. The tool outputs and emails a list of probe sequences antisense to the targeted RNA sequence (Figure 2).
MT-ATP8-201_ENSE00001435286|protein_coding
ATGCCCCAACTAAATACTACCGTATGGCCCACCATAATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAA AAATATTAAACACAAACTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGAGAACCAA AATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAG
MT-ATP8-201_ENSE000014:26-81 TTTAGTTGGGTGATGAGGAATAGTGTAAGGAGTATGGGGGTAATTATGGTGGGCC
MT-ATP8-201_ENSE000014:63-113 AGGGAGGTAGGTGGTAGTTTGTGTTTAATATTTTTAGTTGGGTGATGAGG
MT-ATP8-201_ENSE000014:94-134 TTATTTTTATGGGCTTTGGTGAGGGAGGTAGGTGGTAGTT
MT-ATP8-201_ENSE000014:129-178 ACAGATTTTCGTTCATTTTGGTTCTCAGGGTTTGTTATAATTTTTTATT
MT-ATP8-201_ENSE000014:160-200 GTGGGGGCAATGAATGAAGCGAACAGATTTTCGTTCATTT
The NEBNext Custom RNA Depletion Design Tool designs probes based on the RNA sequence provided. Therefore, non-targeted transcripts with sequence homology to the targeted transcript will also be depleted. To identify potential unintended depletion, it is recommended to check for sequence homology between the targeted sequence and other transcripts. This can be done by using standard sequence homology search tools (e.g., NCBI BLAST, Bowtie2, etc.). Transcripts with high sequence similarity to the targeted RNA will likely be depleted. We have observed depletion of transcripts with ~ 70% homology (or greater), however depletion efficiency will also be influenced by the relative abundance of all homologous sites in your sample.
Ordering and Pooling of the Custom RNA Depletion Probes
The DNA probes can be ordered from your preferred oligo synthesis provider. Standard desalting oligo purification is sufficient for this application. No modifications at the 5´ or 3´ ends are needed.
The synthesis scale to order will depend on the number of reactions and the concentration (μM) of probes required. The NEBNext RNA Depletion Core Reagent Set protocol recommends using 2 μl per reaction of an equimolar probe pool where each probe is at 2 μM. To facilitate pooling, we recommend ordering oligos resuspended to a specific concentration (μM) in 10 mM Tris, 0.1 mM EDTA, pH 7.5. When determining the concentration of probes to order, consider the number of probes to be pooled. For example, a 200-probe pool will require probes to be at least 400 μM each to create a final 2 μM each equimolar pool. Please check with the oligo vendor to determine the minimum guaranteed yield expected for the synthesis scale. For example, ordering a 100 nmol synthesis scale may actually generate 24 nmole oligo. To get a final concentration of 400 μM resuspend probes in 60 μl. Check the concentration of each probe on a spectrophotometer before pooling.
Lyophilized probes can also be used. If lyophilized probes are used, spin down the tube/plate to collect the material prior to resuspension in 10 mM Tris, 0.1mM EDTA, pH 7.5. Ensure that the probes are completely resuspended.
To prevent cross-contamination, we recommend pooling the probes in a PCR hood. Prior to pooling, visually inspect the wells of the plate/tube to ensure material is present. Prepare an equimolar pool with each probe at a final concentration of 2 μM. We recommend first resuspending the probes at a concentration slightly higher than 400 µM, then confirming the concentration using a small aliquot. Adjust the volume as needed to achieve 400 µM before pooling. Follow the steps on the protocol sections to use the custom pool with the NEBNext RNA Depletion Core Reagent Set. Optimization of the amount of each individual probe and probe pool used might be necessary for efficient depletion of your desired RNA. For this it might be practical to pool only a percentage of each of the resuspended oligos so that the concentration of individual oligos can be adjusted by spiking in more of those oligos.
If combining the Custom RNA Depletion Probe Pool with an existing NEBNext depletion solution, please refer to the next section.
Combining a Custom RNA Depletion Probe Pool with Other NEBNext Depletion Solutions
It’s possible to combine a custom RNA depletion probe pool with depletion solutions from the following NEBNext RNA depletion kits:
- NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat), (NEB #E7400, #E7405)
- NEBNext rRNA Depletion Kit (Bacteria), (NEB #E7850, #E7860)
- NEBNext Globin and rRNA Depletion Kit (Human/Mouse/Rat), (NEB #E7750, #E7755)
To do so, set up the probe hybridization reaction (Steps 1.1.2, 2.1.2, 3.1.2, 4.1.2 or 5.1.2 in the protocols found in the manual) as suggested in Table 1, and continue to follow the protocol (in Steps 1.1.3, 2.1.3, 3.1.3, 4.1.3 or 5.1.3) in the corresponding section of this manual, using the reagents in the NEBNext RNA Depletion Core Reagent Set, or the depletion reagents included in the kits.
Table 1. Probe hybridization reaction setup when combining a custom RNA depletion probe pool with existing NEBNext depletion solutions.
|
Core Reagent Set |
rRNA HMR v2 |
Bacteria |
Globin & rRNA HMR |
|
|---|---|---|---|---|
|
Total RNA in Nuclease-free Water |
11 |
9 |
9 |
8 |
|
Hybridization Buffer |
2 |
2 |
2 |
2 |
|
Kit’s Depletion Solution |
– |
2 |
2 |
3 |
|
User Supplied Custom RNA Depletion Probe Pool |
2 |
2 |
2 |
2 |
|
Total Volume |
15 |
15 |
15 |
15 |
* Note: The above recommendations are based on equal abundance of target sequences to be depleted (e.g., 1:1, rRNA: target RNA). If the expected target sequence ratio is variable, the ratio of probes to be combined can be optimized. The ideal probe ratio will vary by sample, and is best determined experimentally.
** Also Note: The recommended volume of user supplied custom RNA depletion probe pool is 2 μl. If a higher or lower volume is desired, adjust the volume of water in the reaction. The total volume of the RNA/Probe Hybridization Reaction must remain at 15 μl.
The adaptor dilution and number of PCR cycles recommended in the library preparation sections of this manual were calculated based on depletion of rRNA, which comprises ~80-90% of total RNA in most samples. Consider the abundance of the depleted RNA in the sample when selecting the adaptor dilution and PCR cycles to use. Additional PCR cycles may be necessary if you deplete other highly abundant RNAs in addition to rRNA.