The guide RNA (crRNA) for EnGen Lba Cas12a has the following sequence: 5´- UAAUUUCUACUAAGUGUAGAUCCACUCACUGCUUUCUCCUC -3´
The underlined sequence is the crRNA repeat and will be the same for all EnGen Lba Cas12a guides. The repeat is followed by a target specific sequence (not underlined), which will vary depending on the target. The targeting sequence can vary from 18-24 nt, but should never contain the PAM (TTTV). The PAM motif should be on the 5´ end of the non-complementary DNA sequence being targeted. Below is an example showing what the DNA sequence for the above crRNA should look like with the PAM underlined.
