Home Resources Troubleshooting Guides Phage Display Troubleshooting Guide (NEB #E8210, #E8211, #E8212)

Phage Display Troubleshooting Guide (NEB #E8210, #E8211, #E8212)

PROBLEM AREA

PROBLEM

CAUSE

SOLUTION

Titering M13

No plaques

F′ of E. coli K12 ER2738 lost
  • Re-streak E. coli K12 ER2738 LB/Tet plate
  • Check Tet stock

Poor bacterial lawn growth
  • Plate incubator must be 37°C
  • Agarose top must be ≤ 54°C

Inconsistent titer results and/or blue
tinged (confluent) plates

Phage solutions not dilute enough
  • Use 109–1011 dilutions for amplified stocks
  • Elution titers will vary widely

Cross-contamination during dilution
steps or plating
  • Use aerosol barrier pipet tips, change at each step

E. coli K12 ER2738 liquid culture or plate contaminated with phage
  • Re-streak E. coli K12 ER2738 on LB/Tet plate
  • Include bacteria alone negative control-plate for titer

Smeared blue coloring on plates

Excess moisture in agarose top or
IPTG/Xgal plates
  • Allow plates to sit at RT or 37°C for 4–8 hrs to dry
  • Difficult to eliminate totally

Amplification

No phage pellet (failed or low yield amplification)

E. coli have lost F′
  • Re-streak E. coli K12 ER2738 LB/Tet plate
  • Check Tet stock

Cells overgrown prior to addition of phage
  • Use 1:100 dilution of overnight culture or add phage at 0.01–0.05 OD600 of same day culture

Failed PEG/NaCl precipitation
  • Titer supernatant to check
  • Use PEG-8000, PEG/NaCl stock should be homogeneous

Poor culture conditions
  • Use ≤ 5 g NaCl per L LB media
  • Aeration must be high (e.g., 250 ml flask for 20 ml culture)

Clear plaques predominate after amplifying elution pool

Environmental contamination from contaminated media, buffers, target or work area
  • Re-make solutions and autoclave
  • Wipe down work area with dilute ethanol or bleach
  • Check E. coli K12 ER2738 plate for contamination

Too many rounds of selection (> 4–5)
  • Modify panning protocol to make binding conditions more stringent
  • Refine elution method

AFTER SELECTIONS

Sequencing phage clones

High A280/A260 for purified ssDNA

Protein contamination, A280/A280 of 3–8 is typical from NaI ssDNA protocol
  • Sequencing reactions should still work
  • For cleaner templates include PCI extractions or use miniprep kit for ss or dsDNA

Poor or no sequencing data

Residual NaI interfering with reactions
  • Try diluting templates 3-fold

If only in random region it is a mixture of templates
  • Pick only well-spaced plaques from plates 1–2 days old maximum

Multiple bands on agarose gel, unexpected sizes

Single- and double- stranded DNA mixture, ssDNA will not migrate with dsDNA of same size
  • Multiple bands is typical -use M13mp18 (NEB #N4040) as control
  • It is difficult to separate completely ss from ds phage DNA; and not necessary for this application

My sequencing facility requires more template or primer than in NEB’s protocol

  
  • We recommend following instructions from the facility. However, we typically use 1 pmol primer and 0.5–1 µg ss template per reaction.

I cannot find random region (displayed peptide codons) in my data

Did not look at reverse compliment of raw data from
-96 glll Sequencing Primer
  • Take reverse compliment, search for KpnI and EagI sites. Compare what is in between these with Fig 4 in manual

Clone has no insert or multiple inserts
  • Usually these are nonspecific binders; phage ELISA will confirm

I am out of sequencing primer solution that came in my kit

Kits provide enough primer to sequence ~100 clones
  • NEB does not sell primers separately
  • Order oligo from your preferred supplier (-96 glll Sequencing Primer: 5´- CCCTCATAGTTAGCGTAACG)

Post-panning analysis

No consensus sequence after 3 rounds

Conformational motif, single clones with specificity
  • Carryout phage ELISA or other binding assay
  • Carryout 4th round of selection

No ELISA signal despite consensus sequence

Selected clones are weak binders
  • Phage ELISA binding is not sensitive enough to detect weaker (mM) interactions

No consensus and no hits from phage ELISA

Selected phage are weak binders, target unrelated selections or no phage were bound
  • Consider modifying panning strategy to eliminate target unrelated binding activity

Synthetic peptides do not bind despite phage particle binding

Phage display 5-copies of each peptide
  • Due to avidity affects, multimers may be required for affinity to the target

Synthetic peptide design is dissimilar to phage
  • C-terminus should not be charged; consider amidation
  • Consider using GGGS linker