How to synthesize a sequence-specific sgRNA for experiments using EnGen^® Sau Cas9

Introduction

Single guide RNAs (sgRNAs) can be synthesized from a variety of double stranded DNA templates. This protocol contains guidelines for the design of sgRNA from a DNA template (annealed oligos, PCR products, synthetic double-stranded DNA templates).

sgRNAs can be synthesized in vitro for use with EnGen® Sau Cas9 using:

• HiScribe™ T7 High Yield RNA Synthesis Kit (NEB #E2040) or
• HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB #E2050)

Protocol

1. Select a 20-22 nucleotide target sequence. The target sequence is based on a specific region that you are trying to target. An online selection tool such as ChopChop, Benchling or Desktop Genetics can also be used to determine a target sequence.
   
   The 20-22 nucleotide target sequence should be directly upstream of the PAM sequence.For Sau, the PAM sequence is 5’ NNGRRT 3’, where N = any nucleotide and R = A or G.The PAM sequence is required for Cas9 recognition but is NOT part of the sgRNA. 
   
   Here is an example:
   
   A potential target sequence (with PAM underlined):
   
   5’ ATCGGAACATGGACTGGACTTCGGAT 3’
   
   
2. Remove the PAM sequence as it will not be included in the sgRNA sequence:
   
   5’ ATCGGAACATGGACTGGACT 3’
   
   
3. For transcription using T7 RNA Polymerase, it is important to have a G in the first position of the target sequence. If there is not a G at this position, add a G to the 5’ end of your target sequence.This sequence will now be 21 nucleotides.
   
   5’ GATCGGAACATGGACTGGACT 3’
   
   
4. Add the T7 promoter sequence (5’ TTCTAATACGACTCACTATA 3’) upstream of the 20 (or 20 + G) nucleotide target-specific sequence. 
   
   5’ TTCTAATACGACTCACTATAGATCGGAACATGGACTGGACT 3’
   
   
5. Add the following DNA sequence to the 3’ end of the T7 promoter/target-specific sequence. This is the sequence that will be recognized by the Sau Cas9 protein:
   
   GTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGATTT
   
   5’TTCTAATACGACTCACTATAGATCGGAACATGGACTGGACTGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGATTT 3’
   
   
   The underlined G indicates the start of transcription.
   
   
6. A complementary DNA oligo of the same length can be ordered and annealed to the oligo described above.The resulting double-stranded DNA would serve as the template for T7 in vitro transcription. 


Please note: These oligos are longer than standard synthesis and may only be offered by certain companies.Alternatively, some companies offer double-strand DNA fragment synthesis service, though the amounts delivered may be low and only enough for a few rounds of in vitro transcription.A PCR step may be included to amplify more dsDNA template for in vitro transcription.


7. Once the dsDNA template is ready, in vitro transcription can be performed using either the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB #E2040) or the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB #E2050), according to the manual.
   
   The final sgRNA sequence will be:
   
   5’GAUCGGAACAUGGACUGGACUGUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUU 3’
   
   Alternatively, a synthetic sgRNA could be ordered from an RNA synthesis company.