The Control LAMP Primer Mix (rActin) targets actin RNA at an exon-exon junction. It is a primer set (F3, B3, FIP, BIP, LF, LB) that amplifies rActin and can be used to confirm the activity of reagents, proper sample handling and the presence of human nucleic acid template in a LAMP reaction.
This product serves as an internal control primer set in the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (NEB #E2019).
Control LAMP Primer Sequences: rActin (5´→ 3´)
rActin Primer Set | Sequence |
---|---|
ACTB-F3 | AGTACCCCATCGAGCACG |
ACTB-B3 | AGCCTGGATAGCAACGTACA |
ACTB-FIP | GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA |
ACTB-BIP | CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC |
ACTB-LF | TGTGGTGCCAGATTTTCTCCA |
ACTB-LB | CGAGAAGATGACCCAGATCATGT |
Based on your Freezer Program type, you are trying to add a product to your cart that is either not allowed or not allowed with the existing contents of your cart. Please review and update your order accordingly If you have any questions, please contact Customer Service at freezers@neb.com or 1-800-632-5227 x 8.
Help us celebrate our 50th anniversary! We have hidden 1,000 golden butterflies and are waiting for you to find them. They can be anywhere that you find NEB! Beginning April 15th, be sure to visit our website and tables at tradeshows and events you are attending. Visit our social media channels frequently for tips on where we have hidden the butterflies – and once you find one, either click or scan the code to be eligible for a 50th anniversary prize pack, as well as a grand prize trip to NEB headquarters in Ipswich, MA!.
To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.