Guidelines for use of Custom RNA Depletion Probe Pools with the NEBNext RNA Depletion Core Reagent Set

Design of Custom RNA Depletion Probes

DNA probes refer to ssDNA oligonucleotides used to remove unwanted RNAs from total RNA in the NEBNext RNase H-based RNA Depletion workflow. To facilitate the design of probes we have created a Custom RNA Depletion Design Tool. The input to the tool is the sequence of the unwanted/targeted RNA, 5´ to 3´ in FASTA format (Figure 1). The input sequence should only contain A, C, G or T nucleotides. The tool outputs and emails a list of probe sequences antisense to the targeted RNA sequence (Figure 2).

Figure 1. Example of input sequence for the Custom RNA Depletion Design Tool.

>MT-ATP8-201_ENSE00001435286|protein_coding
ATGCCCCAACTAAATACTACCGTATGGCCCACCATAATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAA AAATATTAAACACAAACTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGAGAA CCAA AATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAG



Figure 2. Example of probes designed against the MT-ATP8-201 transcript using the Custom RNA Depletion Design Tool.

MT-ATP8-201_ENSE00001435:4-44 GGGTAATTATGGTGGGCCATACGGTAGTATTTAGTTGGGG MT-ATP8-201_ENSE00001435:42-82 TTTTAGTTGGGTGATGAGGAATAGTGTAAGGAGTATGGGG
MT-ATP8-201_ENSE00001435:79-129 TTTATGGGCTTTGGTGAGGGAGGTAGGTGGTAGTTTGTGTTTAATATTTT MT-ATP8-201_ENSE00001435:109-160 TGGTTCTCAGGGTTTGTTATAATTTTTTATTTTTATGGGCTTTGGTGAGGG MT-ATP8-201_ENSE00001435:149-181 GAATGAAGCGAACAGATTTTCGTTCATTTTGGTTCTCAGG



The NEBNext Custom RNA Depletion Design Tool designs probes based on the RNA sequence provided. Therefore, non-targeted transcripts with sequence homology to the targeted transcript will also be depleted. To identify potential unintended depletion, it is recommended to check for sequence homology between the targeted sequence and other transcripts. This can be done by using standard sequence homology search tools (e.g., NCBI BLAST, Bowtie2, etc.). Transcripts with high sequence similarity to the targeted RNA will likely be depleted. We have observed depletion of transcripts with ~ 70% homology (or greater), however depletion efficiency will also be influenced by the relative abundance of all homologous sites in your sample.

Ordering and Pooling of the Custom RNA Depletion Probes

The DNA probes can be ordered from your preferred oligo synthesis provider. Standard desalting oligo purification is sufficient for this application. No modifications at the 5´ or 3´ ends are needed.

The synthesis scale to order will depend on the number of reactions and the concentration (µM) of probes required. The NEBNext RNA Depletion Core Reagent Set protocol recommends using 2 µl per reaction of an equimolar probe pool where each probe is at 2 µM. To facilitate pooling, we recommend ordering oligos resuspended to a specific concentration (µM) in 10 mM Tris, 0.1 mM EDTA, pH 7.5. When determining the concentration of probes to order, consider the number of probes to be pooled. For example a 200-probe pool will require probes to be at least 400 µM each to create a final 2 µM ea equimolar pool. In this example, a 100 nmol synthesis scale would generate 60 µl of probe at 400 µM.

Lyophilized probes can also be used. If lyophilized probes are used, spin down the tube/plate to collect the material prior to resuspension in 10 mM Tris, 0.1mM EDTA, pH 7.5. Ensure that the probes are completely resuspended.

To prevent cross-contamination, we recommend pooling the probes in a PCR hood. Prior to pooling, visually inspect the wells of the plate/tube to ensure material is present.

Prepare an equimolar pool with each probe at a final concentration of 2 µM. Follow the steps on the protocol sections to use the custom pool with the NEBNext RNA Depletion Core Reagent Set. Optimization of the amount of probe used might be necessary for efficient depletion of your desired RNA.

If combining the custom pool with an existing NEBNext depletion solution, please refer to the next section.

Combining a Custom RNA Depletion Probe Pool with Other NEBNext Depletion Solutions

It’s possible to combine a custom RNA depletion probe pool with depletion solutions from the following NEBNext RNA depletion kits:

  1. NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat), (NEB #E7400, #E7405)
  2. NEBNext rRNA Depletion Kit (Bacteria), (NEB #E7850, #E7860)
  3. NEBNext Globin and rRNA Depletion Kit (Human/Mouse/Rat), (NEB #E7750, #E7755)

To do so, set up the probe hybridization reaction (Steps 1.1.2, 2.1.2, 3.1.2, 4.1.2 or 5.1.2 in the protocols found in the manual) as suggested in Table 1, and continue to follow the protocol (in Steps 1.1.3, 2.1.3, 3.1.3, 4.1.3 or 5.1.3) in the corresponding section of this manual, using the reagents in the NEBNext RNA Depletion Core Reagent Set, or the reagents included in the kits.

Table 1. Probe hybridization reaction setup when combining a custom RNA depletion probe pool with existing NEBNext depletion solutions.

 

Core Reagent Set
(NEB #E7865)
Custom Probe Pool Only

rRNA HMR v2
(NEB #E7400)
+ Custom Probe Pool

Bacteria
(NEB #E7860)
+ Custom Probe Pool

Globin & rRNA HMR
(NEB #E7550)
+ Custom Probe Pool

Total RNA in Nuclease-free Water

11

9

9

8

Hybridization Buffer

2

2

2

2

Kit’s Depletion Solution

2

2

3

User Supplied Custom RNA Depletion Probe Pool

2

2

2

2

Total Volume

15

15

15

15

* The above recommendations are based on equal abundance of target sequences to be depleted (e.g., 1:1, rRNA: target RNA). If the expected target sequence ratio is variable, the ratio of probes to be combined can be optimized. The ideal probe ratio will vary by sample, and is best determined experimentally.

** The recommended volume of user supplied custom RNA depletion probe pool is 2 μl. If a higher or lower volume is desired, adjust the volume of water in the reaction. The total volume of the RNA/Probe Hybridization Reaction must remain at 15 μl.

The adaptor dilution and number of PCR cycles recommended in the library preparation sections of this manual were calculated based on depletion of rRNA, which comprises ~80-90% of total RNA in most samples. Consider the abundance of the depleted RNA in the sample when selecting the adaptor dilution and PCR cycles to use. Additional PCR cycles may be necessary if you deplete other highly abundant RNAs in addition to rRNA.