Why Choose Recombinant Enzymes?

Established in 1975 as a private cooperative of experienced scientists, New England Biolabs is a world leader in the production of restriction endonucleases and related products for recombinant DNA technology. NEB has consistently maintained a position at the forefront of this field, and has successfully linked enzyme production efficiency to basic research in the cloning and overexpression of restriction/modification enzyme systems. This enables NEB to introduce substantial cuts in reagent costs and unsurpassed improvements in product quality and purity. Presently, NEB supplies more than 275 restriction enzymes, over 250 of which are available in recombinant form, as well as numerous recombinant polymerases and modifying enzymes for a wide variety of applications.

Why choose a recombinant enzyme?

Purity

Once an enzyme system is cloned, choice of expression vector and strain background allows tight control over the production environment. For restriction endonucleases, this eliminates enzymes known to contaminate native preparations. For example, when producing AvrII (NEB #R0174) from the native strain Anabaena variabilis, great care must be taken to eliminate AvrI. Similarly, when producing HaeIII (NEB #R0108) from Haemophilus aegyptius, the enzyme must be purified free of HaeII (NEB #R0107). Choice of background strain also plays a key role in eliminating nonspecific endonucleases and exonucleases. Although recombinant enzymes and native enzymes are manufactured to meet the same rigorous quality control standards, it is recombinant enzymes that produce a more pure product with less processing time.

Consistency

Typically, the yields obtained for recombinant and overexpressed enzymes are significantly larger than those produced by native strains. Production of larger lots means greater product consistency and less lot-to-lot variation. Further, this large lot capability is ideal for customers that have a need for bulk quantities of enzymes. It simplifies their quality assurance procedures by reducing the time and effort normally spent to qualify enzymes supplied from different lots.

Affordability

At NEB, the introduction of recombinant enzymes has resulted in lower $/unit charges. Recombinant enzymes with lower $/unit cost allows our customers to experience substantial savings, while benefiting from improved purity and consistency of product.

Advances

Cloning does more than increase product quality and purity. There are many examples where native strains do not produce sufficient levels of desirable enzymes. For example, cloning of enzyme systems such as AvrII (NEB #R0174), BcgI (NEB #R0545), BspHI (NEB #R0517), HgaI (NEB #R0154), KasI (NEB #R0544), and NgoMIV (NEB #R0564) has led to these being commercially available. Also, recombinant enzymes are easier to manipulate at the genetic level often leading to the commercialization of new enzymes with useful biochemical properties. For example, the thermal stable enzyme VentR® DNA Polymerase has a 3´ - 5´ exonuclease. Cloning of the VentR® DNA Polymerase gene led to the production of an exo¯ version of the enzyme that is now widely preferred for DNA sequencing.

 Recombinant Enzymes From NEB:

EnzymeSupplied NEBufferSequenceProperties
AatIICutSmart® BufferGACGT/C timesaver 5min
AbaSI @25°CCutSmart® Buffer
Acc65INEBuffer 3.1G/GTACC timesaver 5min dcm
AccICutSmart® BufferGT/MKAC timesaver 5min
AciICutSmart® BufferCCGC(-3/-1) timesaver 5min
AclICutSmart® BufferAA/CGTT timesaver 5min
AcuICutSmart® BufferCTGAAG(16/14) timesaver 5min sam
AfeICutSmart® BufferAGC/GCT
AflIICutSmart® BufferC/TTAAG timesaver 5min
AflIIINEBuffer 3.1A/CRYGT
AgeI §NEBuffer 1.1A/CCGGT
AgeI-HF®CutSmart® BufferA/CCGGT timesaver 5min
AhdICutSmart® BufferGACNNN/NNGTC timesaver 5min
AleICutSmart® BufferCACNN/NNGTG
AluICutSmart® BufferAG/CT timesaver 5min
AlwICutSmart® BufferGGATC(4/5) dam
AlwNICutSmart® BufferCAGNNN/CTG timesaver 5min dcm
ApaI @25°CCutSmart® BufferGGGCC/C timesaver 5min dcm
ApaLICutSmart® BufferG/TGCAC timesaver 5min
ApeKI @75°CNEBuffer 3.1G/CWGC timesaver 5min
EnzymeSupplied NEBufferSequenceProperties
ApoI @50°C §NEBuffer 3.1R/AATTY timesaver 5min
ApoI-HFCutSmart® BufferR/AATTY timesaver 5min
AscICutSmart® BufferGG/CGCGCC timesaver 5min
AseINEBuffer 3.1AT/TAAT timesaver 5min
AsiSICutSmart® BufferGCGAT/CGC
AvaICutSmart® BufferC/YCGRG timesaver 5min
AvaIICutSmart® BufferG/GWCC timesaver 5min dcm
AvrIICutSmart® BufferC/CTAGG timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
BaeGINEBuffer 3.1GKGCM/C timesaver 5min
BaeI @25°CCutSmart® Buffer(10/15)ACNNNNGTAYC(12/7) timesaver 5min sam
BamHI §NEBuffer 3.1G/GATCC timesaver 5min
BamHI-HF®CutSmart® BufferG/GATCC timesaver 5min
BanICutSmart® BufferG/GYRCC dcm
BanIICutSmart® BufferGRGCY/C
BbsI §NEBuffer 2.1GAAGAC(2/6) timesaver 5min
BbsI-HF®CutSmart® BufferGAAGAC(2/6) timesaver 5min
BbvCICutSmart® BufferCCTCAGC(-5/-2)
BbvICutSmart® BufferGCAGC(8/12) timesaver 5min
BccICutSmart® BufferCCATC(4/5)
BceAINEBuffer 3.1ACGGC(12/14)
EnzymeSupplied NEBufferSequenceProperties
BcgINEBuffer 3.1(10/12)CGANNNNNNTGC(12/10) dam sam
BciVICutSmart® BufferGTATCC(6/5) timesaver 5min
BclI @50°CNEBuffer 3.1T/GATCA timesaver 5min dam
BclI-HFCutSmart® BufferT/GATCA timesaver 5min dam
BcoDICutSmart® BufferGTCTC(1/5) timesaver 5min
BfaICutSmart® BufferC/TAG
BfuAI @50°CNEBuffer 3.1ACCTGC(4/8) timesaver 5min
BglINEBuffer 3.1GCCNNNN/NGGC timesaver 5min
BglIINEBuffer 3.1A/GATCT timesaver 5min
BlpICutSmart® BufferGC/TNAGC timesaver 5min
BmgBINEBuffer 3.1CACGTC(-3/-3) timesaver 5min
BmrINEBuffer 2.1ACTGGG(5/4)
BmtI §NEBuffer 3.1GCTAG/C
BmtI-HF®CutSmart® BufferGCTAG/C timesaver 5min
BpmINEBuffer 3.1CTGGAG(16/14)
Bpu10INEBuffer 3.1CCTNAGC(-5/-2)
BpuEICutSmart® BufferCTTGAG(16/14) timesaver 5min sam
BsaAICutSmart® BufferYAC/GTR timesaver 5min
BsaBI @60°CCutSmart® BufferGATNN/NNATC dam
BsaHICutSmart® BufferGR/CGYC timesaver 5min dcm
EnzymeSupplied NEBufferSequenceProperties
BsaI §CutSmart® BufferGGTCTC(1/5) dcm
BsaI-HF®CutSmart® BufferGGTCTC(1/5) timesaver 5min dcm
BsaJI @60°CCutSmart® BufferC/CNNGG
BsaWI @60°CCutSmart® BufferW/CCGGW timesaver 5min
BseRICutSmart® BufferGAGGAG(10/8) timesaver 5min
BseYINEBuffer 3.1CCCAGC(-5/-1)
BsgICutSmart® BufferGTGCAG(16/14) timesaver 5min sam
BsiEI @60°CCutSmart® BufferCGRY/CG timesaver 5min
BsiHKAI @65°CCutSmart® BufferGWGCW/C
BsiWI @55°C §NEBuffer 3.1C/GTACG timesaver 5min
BsiWI-HF®CutSmart® BufferC/GTACG timesaver 5min
BslI @55°CCutSmart® BufferCCNNNNN/NNGG timesaver 5min dcm
BsmAI @55°CCutSmart® BufferGTCTC(1/5) timesaver 5min
BsmBI @55°CNEBuffer 3.1CGTCTC(1/5) timesaver 5min
BsmFI @65°CCutSmart® BufferGGGAC(10/14) dcm
BsmI @65°CCutSmart® BufferGAATGC(1/-1) timesaver 5min
BsoBICutSmart® BufferC/YCGRG timesaver 5min
Bsp1286ICutSmart® BufferGDGCH/C timesaver 5min
BspCNI @25°CCutSmart® BufferCTCAG(9/7) timesaver 5min sam
BspDICutSmart® BufferAT/CGAT dam
EnzymeSupplied NEBufferSequenceProperties
BspEINEBuffer 3.1T/CCGGA timesaver 5min dam
BspHICutSmart® BufferT/CATGA timesaver 5min dam
BspMINEBuffer 3.1ACCTGC(4/8)
BspQI @50°CNEBuffer 3.1GCTCTTC(1/4) timesaver 5min
BsrBICutSmart® BufferCCGCTC(-3/-3) timesaver 5min
BsrDI @65°CNEBuffer 2.1GCAATG(2/0) timesaver 5min
BsrFαICutSmart® BufferR/CCGGY timesaver 5min
BsrFICutSmart® BufferR/CCGGY
BsrGI §NEBuffer 2.1T/GTACA timesaver 5min
BsrGI-HF®CutSmart® BufferT/GTACA timesaver 5min
BssHII @50°CCutSmart® BufferG/CGCGC timesaver 5min
BssKI @60°CCutSmart® Buffer/CCNGG timesaver 5min dcm
BssSαICutSmart® BufferCACGAG(-5/-1) timesaver 5min
BssSINEBuffer 3.1CACGAG(-5/-1)
BstAPI @60°CCutSmart® BufferGCANNNN/NTGC
BstBI @65°CCutSmart® BufferTT/CGAA timesaver 5min
BstEII  @60°C §NEBuffer 3.1G/GTNACC timesaver 5min
BstEII-HF®CutSmart® BufferG/GTNACC timesaver 5min
BstNI @60°CNEBuffer 3.1CC/WGG timesaver 5min
BstXINEBuffer 3.1CCANNNNN/NTGG timesaver 5min dcm
EnzymeSupplied NEBufferSequenceProperties
BstYI @60°CNEBuffer 2.1R/GATCY timesaver 5min
BstZ17I §CutSmart® BufferGTA/TAC timesaver 5min
BstZ17I-HF®CutSmart® BufferGTATAC timesaver 5min
Bsu36ICutSmart® BufferCC/TNAGG timesaver 5min
BtgICutSmart® BufferC/CRYGG timesaver 5min
BtgZI @60°CCutSmart® BufferGCGATG(10/14)
BtsαI @55°CCutSmart® BufferGCAGTG(2/0) timesaver 5min
BtsCI @50°CCutSmart® BufferGGATG(2/0) timesaver 5min
BtsI @55°CCutSmart® BufferGCAGTG(2/0)
BtsIMutI @55°CCutSmart® BufferCAGTG(2/0)
EnzymeBack to topSupplied NEBufferSequenceProperties
ClaICutSmart® BufferAT/CGAT timesaver 5min dam
CspCICutSmart® Buffer(11/13)CAANNNNNGTGG(12/10) timesaver 5min sam
CviAII @25°CCutSmart® BufferC/ATG timesaver 5min
CviKI-1CutSmart® BufferRG/CY
CviQI @25°CNEBuffer 3.1G/TAC timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
DdeICutSmart® BufferC/TNAG timesaver 5min
DpnICutSmart® BufferGA/TC timesaver 5min
DpnIINEBuffer DpnII/GATC timesaver 5min dam
DraICutSmart® BufferTTT/AAA timesaver 5min
DraIII §NEBuffer 3CACNNN/GTG bsa
EnzymeSupplied NEBufferSequenceProperties
DraIII-HF®CutSmart® BufferCACNNN/GTG timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
EaeICutSmart® BufferY/GGCCR dcm
EagI §NEBuffer 3.1C/GGCCG timesaver 5min
EagI-HF®CutSmart® BufferC/GGCCG timesaver 5min
EarICutSmart® BufferCTCTTC(1/4) timesaver 5min
EciICutSmart® BufferGGCGGA(11/9)
Eco53kICutSmart® BufferGAG/CTC timesaver 5min
EcoNICutSmart® BufferCCTNN/NNNAGG timesaver 5min
EcoO109ICutSmart® BufferRG/GNCCY timesaver 5min dcm
EcoP15INEBuffer 3.1CAGCAG(25/27) timesaver 5min
EcoRI §NEBuffer EcoRIG/AATTC timesaver 5min
EcoRI-HF®CutSmart® BufferG/AATTC timesaver 5min
EcoRV §NEBuffer 3.1GAT/ATC timesaver 5min
EcoRV-HF®CutSmart® BufferGAT/ATC timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
FatI @55°CNEBuffer 2.1/CATG
FauI @55°CCutSmart® BufferCCCGC(4/6)
Fnu4HICutSmart® BufferGC/NGC timesaver 5min
FokICutSmart® BufferGGATG(9/13) dcm
FseICutSmart® BufferGGCCGG/CC timesaver 5min dcm
FspEICutSmart® BufferCC(12/16)
EnzymeSupplied NEBufferSequenceProperties
FspICutSmart® BufferTGC/GCA timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
HaeIICutSmart® BufferRGCGC/Y timesaver 5min
HaeIIICutSmart® BufferGG/CC timesaver 5min
HgaINEBuffer 1.1GACGC(5/10)
HhaICutSmart® BufferGCG/C timesaver 5min
HincIINEBuffer 3.1GTY/RAC timesaver 5min
HindIII §NEBuffer 2.1A/AGCTT
HindIII-HF®CutSmart® BufferA/AGCTT timesaver 5min
HinfICutSmart® BufferG/ANTC timesaver 5min
HinP1ICutSmart® BufferG/CGC timesaver 5min
HpaICutSmart® BufferGTT/AAC
HpaIICutSmart® BufferC/CGG timesaver 5min
HphICutSmart® BufferGGTGA(8/7) timesaver 5min dam dcm
Hpy166IICutSmart® BufferGTN/NAC timesaver 5min
Hpy188ICutSmart® BufferTCN/GA dam
Hpy188IIICutSmart® BufferTC/NNGA dam
Hpy99ICutSmart® BufferCGWCG/
HpyAVCutSmart® BufferCCTTC(6/5) timesaver 5min
HpyCH4IIICutSmart® BufferACN/GT
HpyCH4IVCutSmart® BufferA/CGT timesaver 5min
EnzymeSupplied NEBufferSequenceProperties
HpyCH4VCutSmart® BufferTG/CA timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
I-CeuICutSmart® BufferTAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceICutSmart® BufferTAGGGATAACAGGGTAAT(-9/-13)
EnzymeBack to topSupplied NEBufferSequenceProperties
KasICutSmart® BufferG/GCGCC
KpnI §NEBuffer 1.1GGTAC/C
KpnI-HF®CutSmart® BufferGGTAC/C timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
LpnPICutSmart® BufferCCDG(10/14)
EnzymeBack to topSupplied NEBufferSequenceProperties
MboICutSmart® Buffer/GATC timesaver 5min dam
MboIICutSmart® BufferGAAGA(8/7) dam
MfeI §CutSmart® BufferC/AATTG
MfeI-HF®CutSmart® BufferC/AATTG timesaver 5min
MluCICutSmart® Buffer/AATT timesaver 5min
MluI §NEBuffer 3.1A/CGCGT timesaver 5min
MluI-HF®CutSmart® BufferA/CGCGT timesaver 5min
MlyICutSmart® BufferGAGTC(5/5) timesaver 5min
MmeICutSmart® BufferTCCRAC(20/18) timesaver 5min sam
MnlICutSmart® BufferCCTC(7/6) timesaver 5min
MscICutSmart® BufferTGG/CCA dcm
MseICutSmart® BufferT/TAA timesaver 5min
MslICutSmart® BufferCAYNN/NNRTG timesaver 5min
EnzymeSupplied NEBufferSequenceProperties
MspA1ICutSmart® BufferCMG/CKG timesaver 5min
MspICutSmart® BufferC/CGG timesaver 5min
MspJICutSmart® BufferCNNR(9/13)
MwoI @60°CCutSmart® BufferGCNNNNN/NNGC timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
NaeICutSmart® BufferGCC/GGC
NarICutSmart® BufferGG/CGCC
Nb.BbvCICutSmart® BufferCCTCAGC
Nb.BsmI @65°CNEBuffer 3.1GAATGC
Nb.BsrDI @65°CCutSmart® BufferGCAATG
Nb.BssSINEBuffer 3.1CACGAG
Nb.BtsICutSmart® BufferGCAGTG
NciICutSmart® BufferCC/SGG timesaver 5min
NcoI §NEBuffer 3.1C/CATGG timesaver 5min
NcoI-HF®CutSmart® BufferC/CATGG timesaver 5min
NdeICutSmart® BufferCA/TATG timesaver 5min
NgoMIVCutSmart® BufferG/CCGGC timesaver 5min
NheI §NEBuffer 2.1G/CTAGC timesaver 5min
NheI-HF®CutSmart® BufferG/CTAGC timesaver 5min
NlaIIICutSmart® BufferCATG/ timesaver 5min
NlaIVCutSmart® BufferGGN/NCC dcm
EnzymeSupplied NEBufferSequenceProperties
NmeAIIICutSmart® BufferGCCGAG(21/19) sam
NotI §NEBuffer 3.1GC/GGCCGC timesaver 5min
NotI-HF®CutSmart® BufferGC/GGCCGC timesaver 5min
NruI §NEBuffer 3.1TCG/CGA timesaver 5min dam
NruI-HF®CutSmart® BufferTCG/CGA timesaver 5min dam
NsiI §NEBuffer 3.1ATGCA/T timesaver 5min
NsiI-HF®CutSmart® BufferATGCA/T timesaver 5min
NspICutSmart® BufferRCATG/Y timesaver 5min
Nt.AlwICutSmart® BufferGGATC(4/-5) dam
Nt.BbvCICutSmart® BufferCCTCAGC(-5/-7)
Nt.BsmAICutSmart® BufferGTCTC(1/-5)
Nt.BspQI @50°CNEBuffer 3.1GCTCTTC(1/-7)
Nt.BstNBI @55°CNEBuffer 3.1GAGTC(4/-5)
Nt.CviPIICutSmart® Buffer(0/-1)CCD
EnzymeBack to topSupplied NEBufferSequenceProperties
PacICutSmart® BufferTTAAT/TAA timesaver 5min
PaeR7ICutSmart® BufferC/TCGAG timesaver 5min
PciINEBuffer 3.1A/CATGT
PflFICutSmart® BufferGACN/NNGTC timesaver 5min
PflMINEBuffer 3.1CCANNNN/NTGG timesaver 5min dcm
PhoI @75°CCutSmart® BufferGG/CC dcm
EnzymeSupplied NEBufferSequenceProperties
PI-PspI @65°CNEBuffer PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) bsa
PI-SceINEBuffer PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) bsa
PleICutSmart® BufferGAGTC(4/5)
PluTICutSmart® BufferGGCGC/C
PmeICutSmart® BufferGTTT/AAAC timesaver 5min
PmlICutSmart® BufferCAC/GTG timesaver 5min
PpuMICutSmart® BufferRG/GWCCY timesaver 5min dcm
PshAICutSmart® BufferGACNN/NNGTC timesaver 5min
PsiICutSmart® BufferTTA/TAA
PspGI @75°CCutSmart® Buffer/CCWGG dcm
PspOMICutSmart® BufferG/GGCCC dcm
PspXICutSmart® BufferVC/TCGAGB
PstI §NEBuffer 3.1CTGCA/G timesaver 5min
PstI-HF®CutSmart® BufferCTGCA/G timesaver 5min
PvuI §NEBuffer 3.1CGAT/CG timesaver 5min
PvuI-HF®CutSmart® BufferCGAT/CG timesaver 5min
PvuII §NEBuffer 3.1CAG/CTG timesaver 5min
PvuII-HF®CutSmart® BufferCAG/CTG timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
RsaICutSmart® BufferGT/AC timesaver 5min
RsrIICutSmart® BufferCG/GWCCG
EnzymeBack to topSupplied NEBufferSequenceProperties
SacI §NEBuffer 1.1GAGCT/C timesaver 5min
SacI-HF®CutSmart® BufferGAGCT/C timesaver 5min
SacIICutSmart® BufferCCGC/GG timesaver 5min
SalI §NEBuffer 3.1G/TCGAC timesaver 5min
SalI-HF®CutSmart® BufferG/TCGAC timesaver 5min
SapICutSmart® BufferGCTCTTC(1/4) timesaver 5min
Sau3AINEBuffer 1.1/GATC
Sau96ICutSmart® BufferG/GNCC dcm
SbfI §CutSmart® BufferCCTGCA/GG timesaver 5min
SbfI-HF®CutSmart® BufferCCTGCA/GG timesaver 5min
ScaI §NEBuffer 3AGT/ACT
ScaI-HF®CutSmart® BufferAGT/ACT timesaver 5min
ScrFICutSmart® BufferCC/NGG dcm
SexAICutSmart® BufferA/CCWGGT dcm
SfaNINEBuffer 3.1GCATC(5/9)
SfcICutSmart® BufferC/TRYAG
SfiI @50°CCutSmart® BufferGGCCNNNN/NGGCC timesaver 5min dcm
SfoICutSmart® BufferGGC/GCC timesaver 5min dcm
SgrAICutSmart® BufferCR/CCGGYG
SmaI @25°CCutSmart® BufferCCC/GGG timesaver 5min
EnzymeSupplied NEBufferSequenceProperties
SmlI @55°CCutSmart® BufferC/TYRAG
SnaBICutSmart® BufferTAC/GTA
SpeI §CutSmart® BufferA/CTAGT timesaver 5min
SpeI-HF®CutSmart® BufferA/CTAGT timesaver 5min
SphI §NEBuffer 2.1GCATG/C
SphI-HF®CutSmart® BufferGCATG/C timesaver 5min
SrfICutSmart® BufferGCCC/GGGC timesaver 5min
SspI §NEBuffer SspIAAT/ATT timesaver 5min
SspI-HF®CutSmart® BufferAAT/ATT timesaver 5min
StuICutSmart® BufferAGG/CCT timesaver 5min dcm
StyD4ICutSmart® Buffer/CCNGG timesaver 5min dcm
StyI §NEBuffer 3.1C/CWWGG timesaver 5min
StyI-HF®CutSmart® BufferC/CWWGG timesaver 5min
SwaI @25°CNEBuffer 3.1ATTT/AAAT timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
TaqαI @65°CCutSmart® BufferT/CGA timesaver 5min dam
TfiI @65°CCutSmart® BufferG/AWTC timesaver 5min
TliI @75°CNEBuffer 3C/TCGAG bsa
TspRI @65°CCutSmart® BufferNNCASTGNN/ timesaver 5min
Tth111I @65°CCutSmart® BufferGACN/NNGTC timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
XbaICutSmart® BufferT/CTAGA timesaver 5min dam
EnzymeSupplied NEBufferSequenceProperties
XcmINEBuffer 2.1CCANNNNN/NNNNTGG
XhoICutSmart® BufferC/TCGAG timesaver 5min
XmaICutSmart® BufferC/CCGGG timesaver 5min
XmnICutSmart® BufferGAANN/NNTTC timesaver 5min
EnzymeBack to topSupplied NEBufferSequenceProperties
ZraICutSmart® BufferGAC/GTC

§ A HF version of this enzyme is available.