Why Choose Recombinant Enzymes?

Established in 1975 as a private cooperative of experienced scientists, New England Biolabs is a world leader in the production of restriction endonucleases and related products for recombinant DNA technology. NEB has consistently maintained a position at the forefront of this field, and has successfully linked enzyme production efficiency to basic research in the cloning and overexpression of restriction/modification enzyme systems. This enables NEB to introduce substantial cuts in reagent costs and unsurpassed improvements in product quality and purity. Presently, NEB supplies more than 275 restriction enzymes, over 250 of which are available in recombinant form, as well as numerous recombinant polymerases and modifying enzymes for a wide variety of applications.

Why choose a recombinant enzyme?

Purity

Once an enzyme system is cloned, choice of expression vector and strain background allows tight control over the production environment. For restriction endonucleases, this eliminates enzymes known to contaminate native preparations. For example, when producing AvrII (NEB #R0174) from the native strain Anabaena variabilis, great care must be taken to eliminate AvrI. Similarly, when producing HaeIII (NEB #R0108) from Haemophilus aegyptius, the enzyme must be purified free of HaeII (NEB #R0107). Choice of background strain also plays a key role in eliminating nonspecific endonucleases and exonucleases. Although recombinant enzymes and native enzymes are manufactured to meet the same rigorous quality control standards, it is recombinant enzymes that produce a more pure product with less processing time.

Consistency

Typically, the yields obtained for recombinant and overexpressed enzymes are significantly larger than those produced by native strains. Production of larger lots means greater product consistency and less lot-to-lot variation. Further, this large lot capability is ideal for customers that have a need for bulk quantities of enzymes. It simplifies their quality assurance procedures by reducing the time and effort normally spent to qualify enzymes supplied from different lots.

Affordability

At NEB, the introduction of recombinant enzymes has resulted in lower $/unit charges. Recombinant enzymes with lower $/unit cost allows our customers to experience substantial savings, while benefiting from improved purity and consistency of product.

Advances

Cloning does more than increase product quality and purity. There are many examples where native strains do not produce sufficient levels of desirable enzymes. For example, cloning of enzyme systems such as AvrII (NEB #R0174), BcgI (NEB #R0545), BspHI (NEB #R0517), HgaI (NEB #R0154), KasI (NEB #R0544), and NgoMIV (NEB #R0564) has led to these being commercially available. Also, recombinant enzymes are easier to manipulate at the genetic level often leading to the commercialization of new enzymes with useful biochemical properties. For example, the thermal stable enzyme VentR® DNA Polymerase has a 3´ - 5´ exonuclease. Cloning of the VentR® DNA Polymerase gene led to the production of an exo¯ version of the enzyme that is now widely preferred for DNA sequencing.

 Recombinant Enzymes From NEB:

Enzyme Supplied NEBuffer Sequence Properties
AatII CutSmart® Buffer GACGT/C  
AbaSI @25°C CutSmart® Buffer CNNNNNNNNNNN/NNNNNNNNNG
Acc65I NEBuffer™ 3.1 G/GTACC   
AccI CutSmart® Buffer GT/MKAC  
AciI CutSmart® Buffer CCGC(-3/-1)  
AclI CutSmart® Buffer AA/CGTT  
AcuI CutSmart® Buffer CTGAAG(16/14)   
AfeI CutSmart® Buffer AGC/GCT
AflII CutSmart® Buffer C/TTAAG  
AflIII NEBuffer™ 3.1 A/CRYGT
AgeI § NEBuffer™ 1.1 A/CCGGT
AgeI-HF® CutSmart® Buffer A/CCGGT  
AhdI CutSmart® Buffer GACNNN/NNGTC  
AleI-v2 CutSmart® Buffer CACNN/NNGTG
AluI CutSmart® Buffer AG/CT  
AlwI CutSmart® Buffer GGATC(4/5)  
AlwNI CutSmart® Buffer CAGNNN/CTG   
ApaI @25°C CutSmart® Buffer GGGCC/C   
ApaLI CutSmart® Buffer G/TGCAC  
ApeKI @75°C NEBuffer™ 3.1 G/CWGC  
Enzyme Supplied NEBuffer Sequence Properties
ApoI § @50°C NEBuffer™ 3.1 R/AATTY  
ApoI-HF CutSmart® Buffer R/AATTY  
AscI CutSmart® Buffer GG/CGCGCC  
AseI NEBuffer™ 3.1 AT/TAAT  
AsiSI CutSmart® Buffer GCGAT/CGC
AvaI CutSmart® Buffer C/YCGRG  
AvaII CutSmart® Buffer G/GWCC   
AvrII CutSmart® Buffer C/CTAGG  
Enzyme Back to top Supplied NEBuffer Sequence Properties
BaeGI NEBuffer™ 3.1 GKGCM/C  
BaeI @25°C CutSmart® Buffer (10/15)ACNNNNGTAYC(12/7)    
BamHI § NEBuffer™ 3.1 G/GATCC  
BamHI-HF® CutSmart® Buffer G/GATCC  
BanI CutSmart® Buffer G/GYRCC  
BanII CutSmart® Buffer GRGCY/C
BbsI § NEBuffer™ 2.1 GAAGAC(2/6)  
BbsI-HF® CutSmart® Buffer GAAGAC(2/6)  
BbvCI CutSmart® Buffer CCTCAGC(-5/-2)
BbvI CutSmart® Buffer GCAGC(8/12)  
Enzyme Supplied NEBuffer Sequence Properties
BccI CutSmart® Buffer CCATC(4/5)
BceAI NEBuffer™ 3.1 ACGGC(12/14)
BcgI NEBuffer™ 3.1 (10/12)CGANNNNNNTGC(12/10)   
BciVI CutSmart® Buffer GTATCC(6/5)  
BclI § @50°C NEBuffer™ 3.1 T/GATCA   
BclI-HF CutSmart® Buffer T/GATCA   
BcoDI CutSmart® Buffer GTCTC(1/5)  
BfaI CutSmart® Buffer C/TAG
BfuAI @50°C NEBuffer™ 3.1 ACCTGC(4/8)  
BglI NEBuffer™ 3.1 GCCNNNN/NGGC  
BglII NEBuffer™ 3.1 A/GATCT  
BlpI CutSmart® Buffer GC/TNAGC  
BmgBI NEBuffer™ 3.1 CACGTC(-3/-3)  
BmrI NEBuffer™ 2.1 ACTGGG(5/4)
BmtI § NEBuffer™ 3.1 GCTAG/C
BmtI-HF® CutSmart® Buffer GCTAG/C  
BpmI NEBuffer™ 3.1 CTGGAG(16/14)
BpuEI CutSmart® Buffer CTTGAG(16/14)   
Bpu10I NEBuffer™ 3.1 CCTNAGC(-5/-2)
Enzyme Supplied NEBuffer Sequence Properties
BsaAI CutSmart® Buffer YAC/GTR  
BsaBI @60°C CutSmart® Buffer GATNN/NNATC  
BsaHI CutSmart® Buffer GR/CGYC   
BsaI § CutSmart® Buffer GGTCTC(1/5)  
BsaI-HF®v2 CutSmart® Buffer GGTCTC(1/5)   
BsaJI @60°C CutSmart® Buffer C/CNNGG
BsaWI @60°C CutSmart® Buffer W/CCGGW  
BsaXI CutSmart® Buffer (9/12)ACNNNNNCTCC(10/7)  
BseRI CutSmart® Buffer GAGGAG(10/8)  
BseYI NEBuffer™ 3.1 CCCAGC(-5/-1)
BsgI CutSmart® Buffer GTGCAG(16/14)   
BsiEI @60°C CutSmart® Buffer CGRY/CG  
BsiHKAI @65°C CutSmart® Buffer GWGCW/C  
BsiWI § @55°C NEBuffer™ 3.1 C/GTACG  
BsiWI-HF® CutSmart® Buffer C/GTACG  
BslI @55°C CutSmart® Buffer CCNNNNN/NNGG   
BsmAI @55°C CutSmart® Buffer GTCTC(1/5)  
BsmBI @55°C NEBuffer™ 3.1 CGTCTC(1/5)  
BsmFI @65°C CutSmart® Buffer GGGAC(10/14)  
Enzyme Supplied NEBuffer Sequence Properties
BsmI @65°C CutSmart® Buffer GAATGC(1/-1)  
BsoBI CutSmart® Buffer C/YCGRG  
BspCNI @25°C CutSmart® Buffer CTCAG(9/7)   
BspDI CutSmart® Buffer AT/CGAT  
BspEI NEBuffer™ 3.1 T/CCGGA   
BspHI CutSmart® Buffer T/CATGA   
Bsp1286I CutSmart® Buffer GDGCH/C  
BspMI NEBuffer™ 3.1 ACCTGC(4/8)
BspQI @50°C NEBuffer™ 3.1 GCTCTTC(1/4)  
BsrBI CutSmart® Buffer CCGCTC(-3/-3)  
BsrDI @65°C NEBuffer™ 2.1 GCAATG(2/0)  
BsrFI-v2 CutSmart® Buffer R/CCGGY  
BsrGI § NEBuffer™ 2.1 T/GTACA  
BsrGI-HF® CutSmart® Buffer T/GTACA  
BsrI @65°C NEBuffer™ 3.1 ACTGG(1/-1)  
BssHII @50°C CutSmart® Buffer G/CGCGC  
BssSI-v2 CutSmart® Buffer CACGAG(-5/-1)  
BstAPI @60°C CutSmart® Buffer GCANNNN/NTGC
BstBI @65°C CutSmart® Buffer TT/CGAA  
Enzyme Supplied NEBuffer Sequence Properties
BstEII  § @60°C NEBuffer™ 3.1 G/GTNACC  
BstEII-HF® CutSmart® Buffer G/GTNACC  
BstNI @60°C NEBuffer™ 3.1 CC/WGG  
BstUI @60°C CutSmart® Buffer CG/CG  
BstXI NEBuffer™ 3.1 CCANNNNN/NTGG   
BstYI @60°C NEBuffer™ 2.1 R/GATCY  
BstZ17I-HF® CutSmart® Buffer GTATAC  
Bsu36I CutSmart® Buffer CC/TNAGG  
BtgI CutSmart® Buffer C/CRYGG  
BtgZI @60°C CutSmart® Buffer GCGATG(10/14)
BtsCI @50°C CutSmart® Buffer GGATG(2/0)  
BtsIMutI @55°C CutSmart® Buffer CAGTG(2/0)
BtsI-v2 @55°C CutSmart® Buffer GCAGTG(2/0)  
Enzyme Back to top Supplied NEBuffer Sequence Properties
Cac8I CutSmart® Buffer GCN/NGC  
ClaI CutSmart® Buffer AT/CGAT   
CspCI CutSmart® Buffer (11/13)CAANNNNNGTGG(12/10)   
CviAII @25°C CutSmart® Buffer C/ATG  
CviKI-1 CutSmart® Buffer RG/CY
Enzyme Supplied NEBuffer Sequence Properties
CviQI @25°C NEBuffer™ 3.1 G/TAC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
DdeI CutSmart® Buffer C/TNAG  
DpnI CutSmart® Buffer GA/TC  
DpnII NEBuffer™ DpnII /GATC   
DraI CutSmart® Buffer TTT/AAA  
DraIII-HF® CutSmart® Buffer CACNNN/GTG  
DrdI CutSmart® Buffer GACNNNN/NNGTC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
EaeI CutSmart® Buffer Y/GGCCR  
EagI § NEBuffer™ 3.1 C/GGCCG  
EagI-HF® CutSmart® Buffer C/GGCCG  
EarI CutSmart® Buffer CTCTTC(1/4)  
EciI CutSmart® Buffer GGCGGA(11/9)
Eco53kI CutSmart® Buffer GAG/CTC  
EcoNI CutSmart® Buffer CCTNN/NNNAGG  
EcoO109I CutSmart® Buffer RG/GNCCY   
EcoP15I NEBuffer™ 3.1 CAGCAG(25/27)  
EcoRI § NEBuffer™ EcoRI G/AATTC  
Enzyme Supplied NEBuffer Sequence Properties
EcoRI-HF® CutSmart® Buffer G/AATTC  
EcoRV § NEBuffer™ 3.1 GAT/ATC  
EcoRV-HF® CutSmart® Buffer GAT/ATC  
Esp3I CutSmart® Buffer CGTCTC(1/5)  
Enzyme Back to top Supplied NEBuffer Sequence Properties
FatI @55°C NEBuffer™ 2.1
FauI @55°C CutSmart® Buffer CCCGC(4/6)
Fnu4HI CutSmart® Buffer GC/NGC  
FokI CutSmart® Buffer GGATG(9/13)  
FseI CutSmart® Buffer GGCCGG/CC   
FspEI CutSmart® Buffer CC(12/16)
FspI CutSmart® Buffer TGC/GCA  
Enzyme Back to top Supplied NEBuffer Sequence Properties
HaeII CutSmart® Buffer RGCGC/Y  
HaeIII CutSmart® Buffer GG/CC  
HgaI NEBuffer™ 1.1 GACGC(5/10)
HhaI CutSmart® Buffer GCG/C  
HincII NEBuffer™ 3.1 GTY/RAC  
HindIII § NEBuffer™ 2.1 A/AGCTT
Enzyme Supplied NEBuffer Sequence Properties
HindIII-HF® CutSmart® Buffer A/AGCTT  
HinfI CutSmart® Buffer G/ANTC  
HinP1I CutSmart® Buffer G/CGC  
HpaI CutSmart® Buffer GTT/AAC
HpaII CutSmart® Buffer C/CGG  
HphI CutSmart® Buffer GGTGA(8/7)   
HpyAV CutSmart® Buffer CCTTC(6/5)  
HpyCH4III CutSmart® Buffer ACN/GT
HpyCH4IV CutSmart® Buffer A/CGT  
HpyCH4V CutSmart® Buffer TG/CA  
Hpy188I CutSmart® Buffer TCN/GA  
Hpy99I CutSmart® Buffer CGWCG/
Hpy166II CutSmart® Buffer GTN/NAC  
Hpy188III CutSmart® Buffer TC/NNGA  
Enzyme Back to top Supplied NEBuffer Sequence Properties
I-CeuI CutSmart® Buffer TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceI CutSmart® Buffer TAGGGATAACAGGGTAAT(-9/-13)
Enzyme Back to top Supplied NEBuffer Sequence Properties
KasI CutSmart® Buffer G/GCGCC
Enzyme Supplied NEBuffer Sequence Properties
KpnI § NEBuffer™ 1.1 GGTAC/C
KpnI-HF® CutSmart® Buffer GGTAC/C  
Enzyme Back to top Supplied NEBuffer Sequence Properties
LpnPI CutSmart® Buffer CCDG(10/14)
Enzyme Back to top Supplied NEBuffer Sequence Properties
MboI CutSmart® Buffer /GATC   
MboII CutSmart® Buffer GAAGA(8/7)  
MfeI § CutSmart® Buffer C/AATTG
MfeI-HF® CutSmart® Buffer C/AATTG  
MluCI CutSmart® Buffer /AATT  
MluI § NEBuffer™ 3.1 A/CGCGT  
MluI-HF® CutSmart® Buffer A/CGCGT  
MlyI CutSmart® Buffer GAGTC(5/5)  
MmeI CutSmart® Buffer TCCRAC(20/18)    
MnlI CutSmart® Buffer CCTC(7/6)  
MscI CutSmart® Buffer TGG/CCA  
MseI CutSmart® Buffer T/TAA  
MslI CutSmart® Buffer CAYNN/NNRTG  
MspA1I CutSmart® Buffer CMG/CKG  
Enzyme Supplied NEBuffer Sequence Properties
MspI CutSmart® Buffer C/CGG  
MspJI CutSmart® Buffer CNNR(9/13)
MwoI @60°C CutSmart® Buffer GCNNNNN/NNGC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
NaeI CutSmart® Buffer GCC/GGC
NarI CutSmart® Buffer GG/CGCC
Nb.BbvCI CutSmart® Buffer
Nb.BsmI @65°C NEBuffer™ 3.1
Nb.BsrDI @65°C CutSmart® Buffer
Nb.BssSI NEBuffer™ 3.1
Nb.BtsI CutSmart® Buffer
NciI CutSmart® Buffer CC/SGG  
NcoI § NEBuffer™ 3.1 C/CATGG  
NcoI-HF® CutSmart® Buffer C/CATGG  
NdeI CutSmart® Buffer CA/TATG  
NgoMIV CutSmart® Buffer G/CCGGC  
NheI § NEBuffer™ 2.1 G/CTAGC  
NheI-HF® CutSmart® Buffer G/CTAGC  
NlaIII CutSmart® Buffer CATG/  
Enzyme Supplied NEBuffer Sequence Properties
NlaIV CutSmart® Buffer GGN/NCC  
NmeAIII CutSmart® Buffer GCCGAG(21/19)  
NotI § NEBuffer™ 3.1 GC/GGCCGC  
NotI-HF® CutSmart® Buffer GC/GGCCGC  
NruI § NEBuffer™ 3.1 TCG/CGA   
NruI-HF® CutSmart® Buffer TCG/CGA   
NsiI § NEBuffer™ 3.1 ATGCA/T  
NsiI-HF® CutSmart® Buffer ATGCA/T  
NspI CutSmart® Buffer RCATG/Y  
Nt.AlwI CutSmart® Buffer GGATC(4/-5)  
Nt.BbvCI CutSmart® Buffer CCTCAGC(-5/-7)
Nt.BsmAI CutSmart® Buffer GTCTC(1/-5)
Nt.BspQI @50°C NEBuffer™ 3.1 GCTCTTC(1/-7)
Nt.BstNBI @55°C NEBuffer™ 3.1 GAGTC(4/-5)
Nt.CviPII CutSmart® Buffer (0/-1)CCD
Enzyme Back to top Supplied NEBuffer Sequence Properties
PacI CutSmart® Buffer TTAAT/TAA  
PaeR7I CutSmart® Buffer C/TCGAG  
PciI NEBuffer™ 3.1 A/CATGT
Enzyme Supplied NEBuffer Sequence Properties
PflFI CutSmart® Buffer GACN/NNGTC  
PflMI NEBuffer™ 3.1 CCANNNN/NTGG   
PI-PspI @65°C NEBuffer™ PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)  
PI-SceI NEBuffer™ PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)  
PleI CutSmart® Buffer GAGTC(4/5)
PluTI CutSmart® Buffer GGCGC/C
PmeI CutSmart® Buffer GTTT/AAAC  
PmlI CutSmart® Buffer CAC/GTG  
PpuMI CutSmart® Buffer RG/GWCCY   
PshAI CutSmart® Buffer GACNN/NNGTC  
PsiI CutSmart® Buffer TTA/TAA
PspGI @75°C CutSmart® Buffer /CCWGG  
PspOMI CutSmart® Buffer G/GGCCC  
PspXI CutSmart® Buffer VC/TCGAGB
PstI § NEBuffer™ 3.1 CTGCA/G  
PstI-HF® CutSmart® Buffer CTGCA/G  
PvuI § NEBuffer™ 3.1 CGAT/CG  
PvuI-HF® CutSmart® Buffer CGAT/CG  
PvuII § NEBuffer™ 3.1 CAG/CTG  
Enzyme Supplied NEBuffer Sequence Properties
PvuII-HF® CutSmart® Buffer CAG/CTG  
Enzyme Back to top Supplied NEBuffer Sequence Properties
RsaI CutSmart® Buffer GT/AC  
RsrII CutSmart® Buffer CG/GWCCG
Enzyme Back to top Supplied NEBuffer Sequence Properties
SacI § NEBuffer™ 1.1 GAGCT/C  
SacI-HF® CutSmart® Buffer GAGCT/C  
SacII CutSmart® Buffer CCGC/GG  
SalI § NEBuffer™ 3.1 G/TCGAC  
SalI-HF® CutSmart® Buffer G/TCGAC  
SapI CutSmart® Buffer GCTCTTC(1/4)  
Sau3AI NEBuffer™ 1.1 /GATC
Sau96I CutSmart® Buffer G/GNCC  
SbfI § CutSmart® Buffer CCTGCA/GG  
SbfI-HF® CutSmart® Buffer CCTGCA/GG  
ScaI-HF® CutSmart® Buffer AGT/ACT  
ScrFI CutSmart® Buffer CC/NGG  
SexAI CutSmart® Buffer A/CCWGGT  
SfaNI NEBuffer™ 3.1 GCATC(5/9)
Enzyme Supplied NEBuffer Sequence Properties
SfcI CutSmart® Buffer C/TRYAG
SfiI @50°C CutSmart® Buffer GGCCNNNN/NGGCC   
SfoI CutSmart® Buffer GGC/GCC   
SgrAI CutSmart® Buffer CR/CCGGYG
SmaI @25°C CutSmart® Buffer CCC/GGG  
SmlI @55°C CutSmart® Buffer C/TYRAG
SnaBI CutSmart® Buffer TAC/GTA
SpeI § CutSmart® Buffer A/CTAGT  
SpeI-HF® CutSmart® Buffer A/CTAGT  
SphI § NEBuffer™ 2.1 GCATG/C
SphI-HF® CutSmart® Buffer GCATG/C  
SrfI CutSmart® Buffer GCCC/GGGC  
SspI § NEBuffer™ SspI AAT/ATT  
SspI-HF® CutSmart® Buffer AAT/ATT  
StuI CutSmart® Buffer AGG/CCT   
StyD4I CutSmart® Buffer /CCNGG   
StyI § NEBuffer™ 3.1 C/CWWGG  
StyI-HF® CutSmart® Buffer C/CWWGG  
SwaI @25°C NEBuffer™ 3.1 ATTT/AAAT  
Enzyme Supplied NEBuffer Sequence Properties
Enzyme Back to top Supplied NEBuffer Sequence Properties
TaqI-v2 @65°C CutSmart® Buffer T/CGA   
TfiI @65°C CutSmart® Buffer G/AWTC  
TseI @65°C CutSmart® Buffer G/CWGC  
Tsp45I @65°C CutSmart® Buffer /GTSAC
TspMI @75°C CutSmart® Buffer C/CCGGG  
TspRI @65°C CutSmart® Buffer NNCASTGNN/  
Tth111I @65°C CutSmart® Buffer GACN/NNGTC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
XbaI CutSmart® Buffer T/CTAGA   
XcmI NEBuffer™ 2.1 CCANNNNN/NNNNTGG
XhoI CutSmart® Buffer C/TCGAG  
XmaI CutSmart® Buffer C/CCGGG  
XmnI CutSmart® Buffer GAANN/NNTTC  
Enzyme Back to top Supplied NEBuffer Sequence Properties
ZraI CutSmart® Buffer GAC/GTC
Loading Spinner