Frequencies of Restriction Sites

The table below summarizes the frequencies with which restriction endonuclease sites occur in commonly used DNA molecules. Detailed restriction maps can be found on DNA sequences and maps. The sites listed in these tables were identified by computer analysis of published sequences. Although we have tried to ensure their accuracy, the sites have not necessarily been confirmed by experimentation. When the same specificity is displayed by several enzymes, the site is listed by the name of the enzyme that is available from New England Biolabs. Other enzymes with the same specificity are listed in the table of isoschizomers. Recognition sequences are written 5´ to 3´.

DNASU is a central repository for plasmid clones and collections that may also be helpful.

Enzyme Recognition Sequence Adeno-2 Lambda LITMUS28i M13mp18 pBR322 pGLuc-Basic2 pGLuc-Basic pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII GACGT/C 3 10 1 0 1 1 1 0 0 5 1 0 1 1
AbaSI 17
AccI GT/MKAC 17 9 0 1 2 3 3 5 1 2 5 3 1 33
Acc65I G/GTACC 8 2 1 1 0 1 1 0 0 2 0 1 1 5
AciI CCGC(-3/-1) 582 516 27 42 67 66 64 81 80 75 102 92 34 199
AclI AA/CGTT 3 7 3 2 4 2 2 2 5 3 12 9 2 19
AcuI CTGAAG(16/14) 23 40 2 0 2 9 4 8 4 5 2 2 2 1
AfeI AGC/GCT 13 2 0 1 4 0 0 0 2 0 1 2 0 0
AflII C/TTAAG 4 3 0 0 0 0 0 0 0 0 0 0 0 19
AflIII A/CRYGT 25 20 1 3 1 5 1 4 2 5 3 4 1 23
AgeI § A/CCGGT 5 13 1 0 0 0 0 1 0 1 1 0 0 2
AgeI-HF® A/CCGGT 5 13 1 0 0 17 0 1 0 1 0 0 2
AhdI GACNNN/NNGTC 9 9 2 0 1 1 2 1 2 1 2 2 1 14
AleI CACNN/NNGTG 10 20 0 1 0 0 0 1 0 1 0 2 0 8
AluI AG/CT 158 143 15 27 17 31 25 38 28 27 30 34 16 140
AlwI GGATC(4/5) 35 58 10 3 12 21 20 18 12 20 1 1 0 1
AlwNI CAGNNN/CTG 25 41 1 1 1 2 2 5 2 4 1 2 1 15
ApaI GGGCC/C 12 1 0 0 0 0 0 0 1 1 1 1 0 0
ApaLI G/TGCAC 7 4 2 0 3 2 3 3 6 4 4 4 3 1
ApeKI G/CWGC 179 199 9 10 21 22 23 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 3 11 0 3 3 19 5 3 5 7 1 13
ApoI-HF R/AATTY 29 17
AscI GG/CGCGCC 2 2 0 0 0 0 0 0 0 1 0 0 0 0
AseI AT/TAAT 3 17 1 7 1 4 4 5 4 7 10 4 3 12
AsiSI GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0 0 0 0
AvaI C/YCGRG 40 8 2 2 1 2 3 2 1 2 3 1 1 4
AvaII G/GWCC 73 35 2 1 8 4 3 7 9 6 6 8 2 54
AvrII C/CTAGG 2 2 1 0 0 1 1 0 0 1 0 0 0 3
BaeGI GKGCM/C 45 10 2 1 3 4 5 8 8 8 6 5 3 16
BaeI (10/15)ACNNNNGTAYC(12/7) 5 10 1 3 0 1 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 1 1 1 0
BamHI-HF® G/GATCC 3 5 1 1 1 17 1 1 1 1 1 1 0
BanI G/GYRCC 57 25 4 7 9 7 6 7 4 8 8 12 4 33
BanII GRGCY/C 57 7 2 2 2 5 6 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 0 3 2 1 3 3 2 4 4 0 38
BbsI-HF® GAAGAC(2/6) 24 17
BbvCI CCTCAGC(-5/-2) 9 7 0 2 0 0 0 0 0 0 0 0 0 10
BbvI GCAGC(8/12) 179 199 9 10 21 22 23 27 25 20 27 29 12 116
BccI CCATC(4/5) 62 145 5 14 9 25 11 22 16 8 14 14 3 121
BceAI ACGGC(12/14) 80 115 3 7 3 7 5 13 11 8 13 10 2 47
BcgI (10/12)CGANNNNNNTGC(12/10) 10 28 1 0 3 1 1 6 4 1 4 6 1 19
BciVI GTATCC(6/5) 9 26 2 0 2 4 4 3 4 3 4 4 2 23
BclI T/GATCA 5 8 0 0 0 2 1 2 2 1 1 2 0 1
BclI-HF T/GATCA 5 8 17
BcoDI GTCTC(1/5) 60 37 3 5 3 9 3 11 8 4 8 9 4 95
BfaI C/TAG 54 13 7 5 5 12 10 19 3 14 8 8 4 60
BfuAI ACCTGC(4/8) 39 41 0 3 1 5 4 5 4 4 2 3 1 18
BfuCI /GATC 87 116 16 6 22 38 33 35 23 31 24 29 15 6
BglI GCCNNNN/NGGC 20 29 2 1 3 1 1 3 1 7 2 3 2 2
BglII A/GATCT 11 6 1 1 0 3 1 1 1 2 0 2 0 1
BlpI GC/TNAGC 8 6 0 0 0 0 0 0 1 0 1 1 0 20
BmgBI CACGTC(-3/-3) 15 17 0 0 0 1 0 1 1 2 0 0 0 8
BmrI ACTGGG(5/4) 22 4 2 1 5 17 3 2 5 11 8 2 6
BmtI § GCTAG/C 4 1 0 0 1 0 0 4 0 1 1 1 0 1
BmtI-HF® GCTAG/C 17
BpmI CTGGAG(16/14) 32 25 1 2 4 6 4 3 4 1 5 6 1 23
BpuEI CTTGAG(16/14) 19 13 4 4 6 6 6 7 5 9 7 9 4 56
Bpu10I CCTNAGC(-5/-2) 23 169 0 4 1 0 0 0 1 2 0 2 0 39
BsaAI YAC/GTR 22 14 2 5 1 4 2 4 0 3 2 4 0 35
BsaBI GATNN/NNATC 2 21 0 2 1 4 2 2 2 1 1 3 0 7
BsaHI GR/CGYC 44 40 2 1 6 5 5 6 5 8 12 7 3 8
BsaI § GGTCTC(1/5) 18 2 1 0 1 1 1 3 2 2 2 2 1 29
BsaI-HF® GGTCTC(1/5) 18 2 1 0 1 17 1 3 2 2 2 1 29
BsaJI C/CNNGG 234 105 6 9 8 16 21 18 10 17 1 15 5 85
BsaWI W/CCGGW 28 81 4 6 5 4 4 8 7 5 8 6 3 6
BsaXI (9/12)ACNNNNNCTCC(10/7) 29 169 1 4 0 4 3 3 1 1 2 3 1 12
BseRI GAGGAG(10/8) 85 169 0 1 0 2 1 2 0 3 0 0 0 13
BseYI CCCAGC(-5/-1) 31 32 1 3 2 5 5 3 4 5 4 4 1 29
BsgI GTGCAG(16/14) 34 41 0 0 1 1 3 4 6 3 5 4 0 21
BsiEI CGRY/CG 50 22 4 3 7 6 7 11 8 6 9 8 5 17
BsiHKAI GWGCW/C 38 28 4 3 8 6 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 1 0 0 0 0 0 1 0 1 0 0 0
BsiWI-HF® C/GTACG 4 17
BslI CCNNNNN/NNGG 216 176 8 17 20 21 15 18 16 26 31 14 6 90
BsmAI GTCTC(1/5) 60 37 3 5 3 17 3 11 8 8 10 4 95
BsmBI CGTCTC(1/5) 21 14 1 1 1 2 0 2 2 0 2 2 2 16
BsmFI GGGAC(10/14) 59 38 0 2 4 9 7 4 1 5 4 6 0 46
BsmI GAATGC(1/-1) 10 46 1 1 1 4 1 3 1 5 1 0 0 15
BsoBI C/YCGRG 40 8 2 2 1 2 3 2 1 2 3 1 1 4
BspCNI CTCAG(9/7) 75 80 4 24 7 10 8 10 10 9 20 1 5 142
BspDI AT/CGAT 2 15 0 2 1 0 0 2 0 0 0 0 0 3
BspEI T/CCGGA 8 24 0 0 1 0 0 1 2 0 1 1 0 0
BspHI T/CATGA 3 8 2 1 4 2 2 2 1 2 2 3 3 13
Bsp1286I GDGCH/C 105 38 5 5 10 12 15 16 11 15 11 12 5 40
BspMI ACCTGC(4/8) 39 41 0 3 1 5 4 5 4 4 2 3 1 18
BspQI GCTCTTC(1/4) 7 10 0 0 1 3 3 2 1 3 1 1 1 4
BsrBI CCGCTC(-3/-3) 28 17 3 4 2 6 7 6 4 6 9 5 3 17
BsrDI GCAATG(2/0) 83 44 2 3 2 4 3 7 4 4 4 4 2 18
BsrFαI R/CCGGY 40 61 2 1 7 6 6 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 0 1 0 0 0 1 0 1 1 2 0 13
BsrGI-HF® T/GTACA 17
BsrI ACTGG(1/-1) 86 110 11 19 18 17 14 23 26 19 32 28 0 118
BssHII G/CGCGC 52 6 1 0 0 1 1 1 2 2 1 1 0 1
BssSαI CACGAG(-5/-1) 17
BstAPI GCANNNN/NTGC 20 34 0 0 2 2 2 3 2 0 3 2 1 12
BstBI TT/CGAA 1 7 1 0 0 1 1 2 0 0 0 1 0 7
BstEII  § G/GTNACC 10 13 0 0 0 1 0 1 1 0 1 1 0 1
BstEII-HF® G/GTNACC 17
BstNI CC/WGG 136 71 5 7 6 19 14 15 14 19 19 14 5 2
BstUI CG/CG 303 157 11 17 23 35 17 26 31 19 41 35 0 65
BstXI CCANNNNN/NTGG 10 13 0 0 0 2 0 2 4 1 4 3 0 11
BstYI R/GATCY 22 21 8 2 8 16 14 12 9 11 10 12 7 2
BstZ17I-HF® GTATAC 3 3 0 0 1 17 1
Bsu36I CC/TNAGG 7 2 0 1 0 1 0 1 1 1 0 0 0 30
BtgI C/CRYGG 82 46 1 2 2 2 7 4 3 6 1 4 0 26
BtgZI GCGATG(10/14) 23 45 2 4 3 7 6 4 6 6 4 3 0 24
BtsαI GCAGTG(2/0) 17
BtsCI GGATG(2/0) 5 1 4 4 12 16 11 20 17 7 12 18 5 97
BtsIMutI CAGTG(2/0) 20 17
Cac8I GCN/NGC 285 238 12 28 31 29 33 33 32 41 49 35 13 58
ClaI AT/CGAT 2 15 0 2 1 0 0 2 0 0 0 0 0 3
CspCI (11/13)CAANNNNNGTGG(12/10) 6 7 0 1 0 0 0 1 0 1 0 0 0 9
CviAII C/ATG 183 181 9 14 26 25 23 38 23 21 23 31 0 148
CviKI-1 RG/CY 680 692 46 103 73 105 101 131 86 119 112 121 45 562
CviQI G/TAC 83 113 3 19 3 11 3 15 7 14 6 11 3 168
DdeI C/TNAG 97 104 4 30 8 11 9 17 11 11 20 19 6 282
DpnI GA/TC 87 116 16 6 22 38 33 35 23 31 24 29 15 6
DpnII /GATC 87 116 16 6 22 38 33 35 23 31 24 29 15 6
DraI TTT/AAA 12 13 2 5 3 3 3 5 1 6 3 2 3 9
DraIII-HF® CACNNN/GTG 10 10 1 1 0 17 1 2 0 1 1 0 16
DrdI GACNNNN/NNGTC 6 3 2 1 2 3 3 5 2 2 4 4 2 11
EaeI Y/GGCCR 70 39 2 3 6 8 10 10 5 15 4 8 3 2
EagI § C/GGCCG 19 2 0 0 1 2 2 4 1 2 2 2 0 0
EagI-HF® C/GGCCG 19 2 0 0 1 17 2 4 1 2 2 0 0
EarI CTCTTC(1/4) 29 34 2 2 2 5 4 11 6 4 3 5 3 46
EciI GGCGGA(11/9) 29 32 3 2 4 10 9 6 6 8 9 8 3 2
Eco53kI GAG/CTC 16 2 1 1 0 1 1 2 1 2 0 1 1 0
EcoNI CCTNN/NNNAGG 10 9 0 0 1 0 0 3 0 0 2 1 0 1
EcoO109I RG/GNCCY 44 3 0 0 4 1 0 1 2 5 1 3 1 22
EcoP15I CAGCAG(25/27) 50 72 3 4 7 4 4 7 10 6 6 5 3 36
EcoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 1 1 1 0
EcoRI-HF® G/AATTC 5 5 1 1 1 17 1 1 1 1 1 1 0
EcoRV § GAT/ATC 9 21 1 0 1 1 1 1 1 1 1 3 0 0
EcoRV-HF® GAT/ATC 9 21 1 0 1 17 1 1 1 1 3 0 0
FatI /CATG 183 181 9 14 26 25 23 38 23 21 23 31 0 148
FauI CCCGC(4/6) 147 90 5 10 10 10 10 14 17 11 28 22 5 24
Fnu4HI GC/NGC 411 380 16 17 42 46 46 52 42 47 49 52 19 156
FokI GGATG(9/13) 5 1 4 4 12 16 11 20 17 7 12 18 5 97
FseI GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0 0 0 0
FspEI CC(12/16) 17
FspI TGC/GCA 17 15 2 1 4 2 2 3 2 2 1 2 2 7
HaeII RGCGC/Y 76 48 4 6 11 5 5 6 9 3 7 12 3 26
HaeIII GG/CC 216 149 12 15 22 21 24 31 23 36 0 2 0 1
HgaI GACGC(5/10) 87 102 3 7 11 5 6 10 12 7 20 15 4 70
HhaI GCG/C 375 215 19 26 31 17 28 36 39 41 46 17 103
HincII GTY/RAC 25 35 2 1 2 3 3 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 1 1 1 4 0 2 1 0
HindIII-HF® A/AGCTT 12 6 1 1 1 17 1 1 1 0 2 1 0
HinfI G/ANTC 72 148 6 26 10 21 15 31 9 11 16 20 6 218
HinP1I G/CGC 375 215 19 26 31 31 28 36 39 27 41 46 17 103
HpaI GTT/AAC 6 14 1 0 0 0 0 3 1 1 1 2 0 18
HpaII C/CGG 171 328 12 18 26 24 25 32 25 24 50 35 13 58
HphI GGTGA(8/7) 99 168 9 18 12 11 8 15 19 14 0 20 7 102
HpyAV CCTTC(6/5) 84 106 7 14 10 16 12 24 14 11 16 20 6 110
HpyCH4III ACN/GT 122 187 7 31 14 22 11 25 20 15 18 22 8 174
HpyCH4IV A/CGT 83 143 13 22 10 35 11 21 10 19 23 22 5 170
HpyCH4V TG/CA 207 273 10 18 21 32 28 39 28 30 26 27 13 116
Hpy188I TCN/GA 80 170 10 31 15 24 20 24 19 17 19 28 0 153
Hpy99I CGWCG/ 61 102 5 8 9 12 12 14 9 13 18 1 5 29
Hpy166II GTN/NAC 116 125 10 10 8 14 13 29 20 13 27 24 5 199
Hpy188III TC/NNGA 103 185 12 28 19 32 26 32 22 25 27 28 13 173
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0 0
I-SceI TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0 0
KasI G/GCGCC 20 1 0 1 4 1 1 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 1 0 1 1 0 0 2 0 1 1 5
KpnI-HF® GGTAC/C 8 2 1 1 0 17 1 0 0 0 1 1 5
LpnPI CCDG(10/14) 17
MboI /GATC 87 116 16 6 22 38 33 35 23 31 24 29 15 6
MboII GAAGA(8/7) 113 130 10 10 11 18 13 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 0 0 0 2 1 2 1 1 0 8
MfeI-HF® C/AATTG 4 8 0 0 0 17 0 2 1 1 1 0 8
MluCI /AATT 87 189 8 62 8 18 15 15 22 19 31 44 7 79
MluI § A/CGCGT 5 7 0 0 0 0 0 0 1 2 2 1 0 1
MluI-HF® A/CGCGT 17
MlyI GAGTC(5/5) 40 61 6 8 4 8 8 17 5 6 11 10 4 115
MmeI TCCRAC(20/18) 25 18 3 3 4 5 3 8 3 5 4 4 2 33
MnlI CCTC(7/6) 397 262 11 62 26 35 30 56 24 41 35 39 13 342
MscI TGG/CCA 17 18 0 1 1 1 2 0 1 2 0 1 0 2
MseI T/TAA 115 195 15 4 15 18 16 41 24 23 32 39 13 207
MslI CAYNN/NNRTG 35 62 3 3 7 7 5 10 10 6 7 9 3 38
MspA1I CMG/CKG 95 75 4 4 6 9 8 14 11 8 10 12 6 35
MspI C/CGG 171 328 12 18 26 24 25 32 25 24 50 35 13 58
MspJI CNNR(9/13) 17
MwoI GCNNNNN/NNGC 391 347 13 19 34 33 38 33 30 42 41 43 13 170
NaeI GCC/GGC 13 1 0 1 4 3 3 3 0 2 5 5 0 0
NarI GG/CGCC 20 1 0 1 4 1 1 1 1 1 1 4 1 2
Nb.BbvCI CCTCAGC 9 7 0 2 0 17 0 0 0 0 0 0 10
Nb.BsmI GAATGC 10 46 1 1 1 17 1 3 1 1 0 0 15
Nb.BsrDI GCAATG 83 44 2 3 2 3 7 4 4 4 2 18
Nb.BssSI CACGAG 11 8 2 0 3 5 4 5 3 2 4 3 31
Nb.BtsI GCAGTG 22 34 2 1 2 17 5 7 5 4 4 3 20
NciI CC/SGG 97 114 4 4 10 9 10 10 13 9 27 15 7 9
NcoI § C/CATGG 20 4 1 0 0 2 4 1 1 3 0 1 0 1
NcoI-HF® C/CATGG 20 4 1 0 0 17 4 1 1 0 1 0 1
NdeI CA/TATG 2 7 0 3 1 0 0 1 1 1 1 1 1 7
NgoMIV G/CCGGC 13 1 0 1 4 3 3 3 0 2 5 5 0 0
NheI § G/CTAGC 4 1 0 0 1 17 0 4 0 1 1 0 1
NheI-HF® G/CTAGC 4 1 0 0 1 17 0 4 0 1 1 0 1
NlaIII CATG/ 183 181 9 14 26 25 23 38 23 21 23 31 0 148
NlaIV GGN/NCC 178 82 13 18 24 25 18 22 14 20 3 30 0 99
NmeAIII GCCGAG(21/19) 17 8 1 0 3 3 4 2 3 2 2 4 1 14
NotI § GC/GGCCGC 7 0 0 0 0 1 1 1 1 1 1 1 0 0
NotI-HF® GC/GGCCGC 7 0 0 0 0 17 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 0 1 0 1 1 0 1 1 0 0 3
NruI-HF® TCG/CGA 17
NsiI § ATGCA/T 9 14 1 0 0 3 3 6 0 1 0 0 0 8
NsiI-HF® ATGCA/T 17
NspI RCATG/Y 41 32 1 6 4 7 6 9 3 5 5 5 3 24
Nt.AlwI GGATC(4/-5) 35 58 10 3 12 17 20 18 12 1 1 0 1
Nt.BbvCI CCTCAGC(-5/-7) 9 7 0 2 0 0 0 0 0 0 0 10
Nt.BsmAI GTCTC(1/-5) 60 37 3 5 3 17 3 11 8 8 10 4 95
Nt.BspQI GCTCTTC(1/-7) 7 10 0 0 1 17 3 2 1 1 1 1 4
Nt.BstNBI GAGTC(4/-5) 40 61 6 8 4 8 8 17 5 6 11 10 4 115
PacI TTAAT/TAA 1 0 0 1 0 0 0 0 0 1 0 0 0 1
PaeR7I C/TCGAG 6 1 1 0 0 1 2 1 0 1 1 0 0 0
PciI A/CATGT 9 2 1 3 1 2 1 3 1 2 1 1 1 6
PflFI GACN/NNGTC 12 2 0 0 1 2 1 1 1 1 1 2 0 1
PflMI CCANNNN/NTGG 18 14 0 0 2 3 0 3 1 5 2 2 0 8
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0 0
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) 0 0 0 0 0 0 0
PleI GAGTC(4/5) 40 61 6 8 4 8 8 17 5 6 11 10 4 115
PluTI GGCGC/C 17
PmeI GTTT/AAAC 1 2 0 0 0 0 0 0 0 1 1 0 0 2
PmlI CAC/GTG 10 3 0 0 0 1 0 0 0 1 0 1 0 1
PpuMI RG/GWCCY 23 3 0 0 2 1 0 1 2 1 0 0 0 12
PshAI GACNN/NNGTC 2 7 0 0 1 1 0 1 0 0 1 2 0 6
PsiI TTA/TAA 4 113 1 2 0 2 2 2 1 1 1 1 0 5
PspGI /CCWGG 136 71 5 7 6 19 14 15 14 19 19 14 5 2
PspOMI G/GGCCC 12 1 0 0 0 0 0 0 1 1 1 1 0 0
PspXI VC/TCGAGB 3 1 0 0 0 1 2 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 1 2 2 3 1 4 1 1 1 0
PstI-HF® CTGCA/G 30 28 1 1 1 17 2 3 1 1 1 1 0
PvuI § CGAT/CG 7 3 2 1 1 1 2 2 1 1 2 2 0
PvuI-HF® CGAT/CG 7 3 2 1 1 17 2 3 2 1 2 2 0
PvuII § CAG/CTG 24 15 1 3 1 5 3 3 3 3 3 4 2 3
PvuII-HF® CAG/CTG 24 15 1 3 1 17 3 3 3 3 4 2 3
RsaI GT/AC 83 113 3 19 3 11 3 15 7 14 6 11 3 168
RsrII CG/GWCCG 2 5 0 0 0 1 1 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 1 0 12 1 2 1 2 0 1 1 0
SacI-HF® GAGCT/C 16 2 1 1 0 17 1 2 1 0 1 1 0
SacII CCGC/GG 33 4 0 0 0 0 1 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 0 1 1 1 3 1 1 1 4 1 1 0
SalI-HF® G/TCGAC 3 2 0 1 1 17 3 1 1 4 1 1 0
SapI GCTCTTC(1/4) 7 10 0 0 1 3 3 2 1 3 1 1 1 4
Sau3AI /GATC 87 116 16 6 22 38 33 35 23 31 24 29 15 6
Sau96I G/GNCC 164 74 6 4 15 7 8 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 1 0 0 0 1 1 0 1 1 0
SbfI-HF® CCTGCA/GG 3 5 1 1 0 17 0 1 1 0 1 1 0
ScaI-HF® AGT/ACT 5 5 1 0 1 17 1 2 1 1 2 1 4
ScrFI CC/NGG 233 185 9 11 16 28 24 25 27 28 46 29 12 11
SexAI A/CCWGGT 9 5 0 0 0 2 1 3 0 0 0 0 0 0
SfaNI GCATC(5/9) 85 169 5 7 22 20 19 18 20 17 23 19 8 96
SfcI C/TRYAG 47 38 7 7 4 9 6 9 4 10 6 8 4 48
SfiI GGCCNNNN/NGGCC 3 0 0 0 0 0 0 0 0 1 0 0 0 1
SfoI GGC/GCC 20 1 0 1 4 1 1 1 1 1 1 4 1 2
SgrAI CR/CCGGYG 6 6 0 0 1 0 0 0 0 0 1 1 0 0
SmaI CCC/GGG 12 3 0 1 0 1 1 1 0 1 0 0 1 0
SmlI C/TYRAG 29 17 5 4 6 7 8 8 5 10 8 9 4 75
SnaBI TAC/GTA 0 1 1 1 0 0 0 1 0 1 0 0 0 13
SpeI § A/CTAGT 3 0 0 0 0 0 0 0 0 1 1 1 0 2
SpeI-HF® A/CTAGT 17
SphI § GCATG/C 8 6 0 1 1 4 5 2 0 2 2 1 1 0
SphI-HF® GCATG/C 8 6 0 1 1 17 5 2 0 2 1 1 0
SrfI GCCC/GGGC 17
SspI § AAT/ATT 5 20 3 6 1 1 1 6 2 1 3 5 1 6
SspI-HF® AAT/ATT 5 20 3 6 1 17 1 6 2 3 5 1 6
StuI AGG/CCT 11 6 1 0 0 1 1 1 0 0 1 1 0 1
StyD4I /CCNGG 233 185 9 11 16 28 24 25 27 28 46 29 12 11
StyI § C/CWWGG 44 10 2 0 1 5 5 4 1 4 2 4 0 36
StyI-HF® C/CWWGG 44 10 2 0 1 17 5 4 1 2 4 0 36
SwaI ATTT/AAAT 1 0 1 1 0 0 0 0 0 1 1 1 0 1
TaqαI T/CGA 50 121 5 12 7 17 17 32 16 15 3 17 4 111
TfiI G/AWTC 32 87 0 18 6 13 7 14 4 5 5 10 2 103
TseI G/CWGC 179 199 9 10 21 22 23 27 25 20 27 29 12 116
Tsp45I /GTSAC 73 81 6 9 9 8 6 9 7 5 12 13 4 108
TspMI C/CCGGG 12 3 0 1 0 1 1 1 0 1 0 0 1 0
TspRI NNCASTGNN/ 83 119 7 9 11 35 12 22 14 16 16 15 0 94
Tth111I GACN/NNGTC 12 2 0 0 1 2 1 1 1 1 1 2 0 1
XbaI T/CTAGA 5 1 1 1 0 1 1 1 0 1 1 1 1 3
XcmI CCANNNNN/NNNNTGG 83 113 0 0 0 1 0 1 3 0 3 4 0 8
XhoI C/TCGAG 6 1 1 0 0 1 2 1 0 1 1 0 0 0
XmaI C/CCGGG 12 3 0 1 0 1 1 1 0 1 0 0 1 0
XmnI GAANN/NNTTC 5 24 0 2 2 3 4 3 1 3 7 2 1 12
ZraI GAC/GTC 3 10 1 0 1 1 1 0 0 5 1 0 1 1

§ An HF version of this enzyme is available.
Loading Spinner