New England Biolabs: Reagents for the Life Sciences Industry

Enzyme Finder

Use this tool to select restriction enzymes by name, sequence, overhang or type.  Enter your sequence using single letter code nomenclature, and Enzyme Finder will identify the right enzyme for the job. In search results, enzymes supplied by NEB are listed first with their NEB icons, and displayed as links to their product page.

EnzymeSequenceCut SiteOverhangProperties
BbvCICCTCAGC
CC/TCAGC
GGAGT/CG
5′ - TCA cpg recombinant cloned at neb heat inactivation no icon_CutSmart incubation temp
BlpIGCTNAGC
GC/TNAGC
CGANT/CG
5′ - TNA timesaver 5min recombinant cloned at neb heat inactivation no icon_CutSmart incubation temp
Bpu10ICCTNAGC
CC/TNAGC
GGANT/CG
5′ - TNA recombinant cloned at neb heat inactivation yes icon_neb3_1 incubation temp
BspQIGCTCTTC
GCTCTTCN/NNN
CGAGAAGNNNN/
5′ - NNN timesaver 5min recombinant cloned at neb heat inactivation yes icon_neb3_1 incubation temp
BstEII GGTNACC
G/GTNACC
CCANTG/G
5′ - GTNAC timesaver 5min recombinant cloned at neb heat inactivation no icon_neb3_1 incubation temp
BstEII-HF® RE-Mix®GGTNACC
G/GTNACC
CCANTG/G
5′ - GTNAC timesaver 5min recombinant cloned at neb heat inactivation no incubation temp engineered
Bsu36ICCTNAGG
CC/TNAGG
GGANT/CC
5′ - TNA timesaver 5min recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
EcoO109IRGGNCCY
RG/GNCCY
YCCNG/GR
5′ - GNC timesaver 5min dcm recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp blue white
Nb.BbvCICCTCAGC
CCTCAGC
GGAGT/CG
nick recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
Nt.BbvCICCTCAGC
CC/TCAGC
GGAGTCG
nick cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
Nt.BspQIGCTCTTC
GCTCTTCN/
CGAGAAGN
nick recombinant cloned at neb heat inactivation yes icon_neb3_1 incubation temp
PpuMIRGGWCCY
RG/GWCCY
YCCWG/GR
5′ - GWC timesaver 5min dcm recombinant cloned at neb heat inactivation no icon_CutSmart incubation temp
RsrIICGGWCCG
CG/GWCCG
GCCWG/GC
5′ - GWC cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
SapIGCTCTTC
GCTCTTCN/NNN
CGAGAAGNNNN/
5′ - NNN timesaver 5min recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
SexAIACCWGGT
A/CCWGGT
TGGWCC/A
5′ - CCWGG dcm recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
AscIGGCGCGCC
GG/CGCGCC
CCGCGC/GG
5′ - CGCG timesaver 5min cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp blue white
AscI RE-Mix®GGCGCGCC
GG/CGCGCC
CCGCGC/GG
5′ - CGCG timesaver 5min cpg recombinant cloned at neb heat inactivation yes incubation temp
AsiSIGCGATCGC
GCGAT/CGC
CGC/TAGCG
AT- 3′ cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
FseIGGCCGGCC
GGCCGG/CC
CC/GGCCGG
CCGG- 3′ timesaver 5min dcm cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
NotIGCGGCCGC
GC/GGCCGC
CGCCGG/CG
5′ - GGCC timesaver 5min cpg recombinant cloned at neb heat inactivation yes icon_neb3_1 incubation temp
NotI-HF®GCGGCCGC
GC/GGCCGC
CGCCGG/CG
5′ - GGCC timesaver 5min cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp engineered
NotI-HF® RE-Mix® GCGGCCGC
GC/GGCCGC
CGCCGG/CG
5′ - GGCC timesaver 5min cpg recombinant cloned at neb heat inactivation yes incubation temp engineered
PacITTAATTAA
TTAAT/TAA
AAT/TAATT
AT- 3′ timesaver 5min recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp blue white
PacI RE-Mix®TTAATTAA
TTAAT/TAA
AAT/TAATT
AT- 3′ timesaver 5min recombinant cloned at neb heat inactivation yes incubation temp
PmeIGTTTAAAC
GTTT/AAAC
CAAA/TTTG
blunt timesaver 5min cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp blue white
PspXIVCTCGAGB
VC/TCGAGB
BGAGCT/CV
5′ - TCGA cpg recombinant cloned at neb heat inactivation no icon_CutSmart incubation temp
SbfICCTGCAGG
CCTGCA/GG
GG/ACGTCC
TGCA- 3′ timesaver 5min recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
SbfI-HF®CCTGCAGG
CCTGCA/GG
GG/ACGTCC
TGCA- 3′ timesaver 5min recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp engineered
SgrAICRCCGGYG
CR/CCGGYG
GYGGCC/RC
5′ - CCGG cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
SrfIGCCCGGGC
GCCC/GGGC
CGGG/CCCG
blunt timesaver 5min cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp engineered
SwaIATTTAAAT
ATTT/AAAT
TAAA/TTTA
blunt timesaver 5min recombinant cloned at neb heat inactivation yes icon_neb3_1 25 degree incubation temp
AlwNICAGNNNCTG
CAGNNN/CTG
GTC/NNNGAC
NNN- 3′ timesaver 5min dcm recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
DraIIICACNNNGTG
CACNNN/GTG
GTG/NNNCAC
NNN- 3′ cpg recombinant cloned at neb heat inactivation yes NEBuffer 3 incubation temp 
DraIII-HF®CACNNNGTG
CACNNN/GTG
GTG/NNNCAC
NNN- 3′ timesaver 5min cpg recombinant cloned at neb heat inactivation no icon_CutSmart incubation temp engineered
PflFIGACNNNGTC
GACN/NNGTC
CTGNN/NCAG
5′ - N timesaver 5min recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
Tth111IGACNNNGTC
GACN/NNGTC
CTGNN/NCAG
5′ - N timesaver 5min recombinant cloned at neb heat inactivation no icon_CutSmart incubation temp
AleICACNNNNGTG
CACNN/NNGTG
GTGNN/NNCAC
blunt cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
BsaBIGATNNNNATC
GATNN/NNATC
CTANN/NNTAG
blunt dam cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
MslICAYNNNNRTG
CAYNN/NNRTG
GTRNN/NNYAC
blunt timesaver 5min recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
PshAIGACNNNNGTC
GACNN/NNGTC
CTGNN/NNCAG
blunt timesaver 5min cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
XmnIGAANNNNTTC
GAANN/NNTTC
CTTNN/NNAAG
blunt timesaver 5min recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp blue white
AhdIGACNNNNNGTC
GACNNN/NNGTC
CTGNN/NNNCAG
N- 3′ timesaver 5min cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
BaeIACNNNNGTAYC
NNNNN/NNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNN/
/NNNNNNNNNNNNNNNTGNNNNCATRGNNNNNNN/NNNNN
NNNNN- 3′ timesaver 5min cpg recombinant cloned at neb heat inactivation yes icon_CutSmart 25 degree incubation temp  sam
BglIGCCNNNNNGGC
GCCNNNN/NGGC
CGGN/NNNNCCG
NNN- 3′ timesaver 5min cpg recombinant cloned at neb heat inactivation yes icon_neb3_1 incubation temp
BsaXIACNNNNNCTCC
NNN/NNNNNNNNNACNNNNNCTCCNNNNNNNNNN/
/NNNNNNNNNNNNTGNNNNNGAGGNNNNNNN/NNN
NNN- 3′ timesaver 5min heat inactivation no icon_CutSmart incubation temp
BslICCNNNNNNNGG
CCNNNNN/NNGG
GGNN/NNNNNCC
NNN- 3′ timesaver 5min dcm cpg recombinant cloned at neb heat inactivation no icon_CutSmart incubation temp
BstAPIGCANNNNNTGC
GCANNNN/NTGC
CGTN/NNNNACG
NNN- 3′ cpg recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
EcoNICCTNNNNNAGG
CCTNN/NNNAGG
GGANNN/NNTCC
5′ - N timesaver 5min recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp
MwoIGCNNNNNNNGC
GCNNNNN/NNGC
CGNN/NNNNNCG
NNN- 3′ timesaver 5min cpg recombinant cloned at neb heat inactivation no icon_CutSmart incubation temp
PflMICCANNNNNTGG
CCANNNN/NTGG
GGTN/NNNNACC
NNN- 3′ timesaver 5min dcm recombinant cloned at neb heat inactivation yes icon_neb3_1 incubation temp
BcgICGANNNNNNTGC
NN/NNNNNNNNNNCGANNNNNNTGCNNNNNNNNNNNN/
/NNNNNNNNNNNNGCTNNNNNNACGNNNNNNNNNN/NN
NN- 3′ dam cpg recombinant cloned at neb heat inactivation yes icon_neb3_1 incubation temp  sam
BstXICCANNNNNNTGG
CCANNNNN/NTGG
GGTN/NNNNNACC
NNNN- 3′ timesaver 5min dcm recombinant cloned at neb heat inactivation yes icon_neb3_1 incubation temp
CspCICAANNNNNGTGG
NN/NNNNNNNNNNNCAANNNNNGTGGNNNNNNNNNNNN/
/NNNNNNNNNNNNNGTTNNNNNCACCNNNNNNNNNN/NN
NN- 3′ timesaver 5min recombinant cloned at neb heat inactivation yes icon_CutSmart incubation temp  sam
DrdIGACNNNNNNGTC
GACNNNN/NNGTC
CTGNN/NNNNCAG
NN- 3′ timesaver 5min cpg heat inactivation yes icon_CutSmart incubation temp
SfiIGGCCNNNNNGGCC
GGCCNNNN/NGGCC
CCGGN/NNNNCCGG
NNN- 3′ timesaver 5min dcm cpg recombinant cloned at neb heat inactivation no icon_CutSmart incubation temp
XcmICCANNNNNNNNNTGG
CCANNNNN/NNNNTGG
GGTNNNN/NNNNNACC
N- 3′ recombinant cloned at neb heat inactivation yes icon_neb2_1 incubation temp
I-SceITAGGGATAACAGGGTAAT
TAGGGATAA/CAGGGTAAT
ATCCC/TATTGTCCCATTA
ATAA- 3′ recombinant heat inactivation yes icon_CutSmart incubation temp
I-CeuITAACTATAACGGTCCTAAGGTAGCGAA
TAACTATAACGGTCCTAA/GGTAGCGAA
ATTGATATTGCCAG/GATTCCATCGCTT
CTAA- 3′ recombinant heat inactivation yes icon_CutSmart incubation temp
PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT
TGGCAAACAGCTATTAT/GGGTATTATGGGT
ACCGTTTGTCGAT/AATACCCATAATACCCA
TTAT- 3′ recombinant cloned at neb heat inactivation no unique buffer incubation temp 
PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT
ATCTATGTCGGGTGC/GGAGAAAGAGGTAAT
TAGATACAGCC/CACGCCTCTTTCTCCATTA
GTGC- 3′ recombinant heat inactivation yes unique buffer incubation temp 
AarI CACCTGC
CACCTGCNNNN/NNNN
GTGGACGNNNNNNNN/
5′ - NNNN
AocI CCTNAGG
CC/TNAGG
GGANT/CC
5′ - TNA
AquIIGCCGNAC
GCCGNACNNNNNNNNNNNNNNNNNNNN/
CGGCNTGNNNNNNNNNNNNNNNNNN/NN
NN- 3′
AquIVGRGGAAG
GRGGAAGNNNNNNNNNNNNNNNNNNN/
CYCCTTCNNNNNNNNNNNNNNNNN/NN
NN- 3′
AxyI CCTNAGG
CC/TNAGG
GGANT/CC
5′ - TNA
BfaSIIGANGGAG
GANGGAG
CTNCCTC
No Sequence Supplied
Bpu1102IGCTNAGC
GC/TNAGC
CGANT/CG
5′ - TNA
Bse21ICCTNAGG
CC/TNAGG
GGANT/CC
5′ - TNA
Bsp1720IGCTNAGC
GC/TNAGC
CGANT/CG
5′ - TNA
BstPIGGTNACC
G/GTNACC
CCANTG/G
5′ - GTNAC
CcrNAIIICGACCAG
CGACCAG
GCTGGTC
No Sequence Supplied
CelIIGCTNAGC
GC/TNAGC
CGANT/CG
5′ - TNA
Cgl13032IIACGABGG
ACGABGG
TGCTVCC
No Sequence Supplied
Cly7489IIAAAACRG
AAAACRG
TTTTGYC
No Sequence Supplied
CpoICGGWCCG
CG/GWCCG
GCCWG/GC
5′ - GWC
CsiIACCWGGT
A/CCWGGT
TGGWCC/A
5′ - CCWGG
CspICGGWCCG
CG/GWCCG
GCCWG/GC
5′ - GWC
CvnICCTNAGG
CC/TNAGG
GGANT/CC
5′ - TNA
DraIIRGGNCCY
RG/GNCCY
YCCNG/GR
5′ - GNC
DraRICAAGNAC
CAAGNACNNNNNNNNNNNNNNNNNNNN/
GTTCNTGNNNNNNNNNNNNNNNNNN/NN
NN- 3′
DvuIIICACNCAC
CACNCAC
GTGNGTG
No Sequence Supplied
Eco065IGGTNACC
G/GTNACC
CCANTG/G
5′ - GTNAC
Eco81ICCTNAGG
CC/TNAGG
GGANT/CC
5′ - TNA
Eco91IGGTNACC
G/GTNACC
CCANTG/G
5′ - GTNAC
EcoO65IGGTNACC
G/GTNACC
CCANTG/G
5′ - GTNAC
EspIGCTNAGC
GC/TNAGC
CGANT/CG
5′ - TNA
KflIGGGWCCC
GG/GWCCC
CCCWG/GG
5′ - GWC
LguIGCTCTTC
GCTCTTCN/NNN
CGAGAAGNNNN/
5′ - NNN
LlaGICTNGAYG
CTNGAYG
GANCTRC
No Sequence Supplied
MabIACCWGGT
A/CCWGGT
TGGWCC/A
5′ - CCWGG
MaqICRTTGAC
CRTTGACNNNNNNNNNNNNNNNNNNNNN/
GYAACTGNNNNNNNNNNNNNNNNNNN/NN
NN- 3′
MkaDIIGAGAYGT
GAGAYGT
CTCTRCA
No Sequence Supplied
MtuHN878IICACGCAG
CACGCAG
GTGCGTC
No Sequence Supplied
NhaXICAAGRAG
CAAGRAG
GTTCYTC
No Sequence Supplied
PasI CCCWGGG
CC/CWGGG
GGGWC/CC
5′ - CWG
PciSI GCTCTTC
GCTCTTCN/NNN
CGAGAAGNNNN/
5′ - NNN
PfoI TCCNGGA
T/CCNGGA
AGGNCC/T
5′ - CCNGG
PpuXI RGGWCCY
RG/GWCCY
YCCWG/GR
5′ - GWC
Psp5II RGGWCCY
RG/GWCCY
YCCWG/GR
5′ - GWC
PspEI GGTNACC
G/GTNACC
CCANTG/G
5′ - GTNAC
PspOMIICGCCCAR
CGCCCARNNNNNNNNNNNNNNNNNNNN/
GCGGGTYNNNNNNNNNNNNNNNNNN/NN
NN- 3′
PssIRGGNCCY
RGGNC/CY
YCCNGGR
nick
RceICATCGAC
CATCGACNNNNNNNNNNNNNNNNNNNN/
GTAGCTGNNNNNNNNNNNNNNNNNN/NN
NN- 3′
RpaB5ICGRGGAC
CGRGGACNNNNNNNNNNNNNNNNNNNN/
GCYCCTGNNNNNNNNNNNNNNNNNN/NN
NN- 3′
RpaBICCCGCAG
CCCGCAGNNNNNNNNNNNNNNNNNNNN/
GGGCGTCNNNNNNNNNNNNNNNNNN/NN
NN- 3′
RpaIGTYGGAG
GTYGGAGNNNNNNNNNNN/
CARCCTCNNNNNNNNN/NN
NN- 3′
RpaTIGRTGGAG
GRTGGAG
CYACCTC
No Sequence Supplied
Rsr2ICGGWCCG
CG/GWCCG
GCCWG/GC
5′ - GWC
SanDIGGGWCCC
GG/GWCCC
CCCWG/GG
5′ - GWC
SauICCTNAGG
CC/TNAGG
GGANT/CC
5′ - TNA
Sno506IGGCCGAG
GGCCGAG
CCGGCTC
No Sequence Supplied
SpoDIGCGGRAG
GCGGRAG
CGCCYTC
No Sequence Supplied
Sse8647IAGGWCCT
AG/GWCCT
TCCWG/GA
5′ - GWC
SstE37ICGAAGAC
CGAAGACNNNNNNNNNNNNNNNNNNNN/
GCTTCTGNNNNNNNNNNNNNNNNNN/NN
NN- 3′
Sth20745IIIGGACGAC
GGACGAC
CCTGCTG
No Sequence Supplied
AbsI CCTCGAGG
CC/TCGAGG
GGAGCT/CC
5′ - TCGA
CciNIGCGGCCGC
GC/GGCCGC
CGCCGG/CG
5′ - GGCC
FspAIRTGCGCAY
RTGC/GCAY
YACG/CGTR
blunt
GauT27ICGCGCAGG
CGCGCAGG
GCGCGTCC
No Sequence Supplied
MauBICGCGCGCG
CG/CGCGCG
GCGCGC/GC
5′ - CGCG
MreICGCCGGCG
CG/CCGGCG
GCGGCC/GC
5′ - CCGG
MssIGTTTAAAC
GTTT/AAAC
CAAA/TTTG
blunt
PalAI GGCGCGCC
GG/CGCGCC
CCGCGC/GG
5′ - CGCG
RgaIGCGATCGC
GCGAT/CGC
CGC/TAGCG
AT- 3′
RigIGGCCGGCC
GGCCGG/CC
CC/GGCCGG
CCGG- 3′
SdaICCTGCAGG
CCTGCA/GG
GG/ACGTCC
TGCA- 3′
SfaAIGCGATCGC
GCGAT/CGC
CGC/TAGCG
AT- 3′
SgfIGCGATCGC
GCGAT/CGC
CGC/TAGCG
AT- 3′
SgrDICGTCGACG
CG/TCGACG
GCAGCT/GC
5′ - TCGA
SgsIGGCGCGCC
GG/CGCGCC
CCGCGC/GG
5′ - CGCG
SmiIATTTAAAT
ATTT/AAAT
TAAA/TTTA
blunt
Sse232ICGCCGGCG
CG/CCGGCG
GCGGCC/GC
5′ - CCGG
Sse8387ICCTGCAGG
CCTGCA/GG
GG/ACGTCC
TGCA- 3′
AdeI CACNNNGTG
CACNNN/GTG
GTG/NNNCAC
NNN- 3′
AspI GACNNNGTC
GACN/NNGTC
CTGNN/NCAG
5′ - N
CaiICAGNNNCTG
CAGNNN/CTG
GTC/NNNGAC
NNN- 3′
PstNICAGNNNCTG
CAGNNN/CTG
GTC/NNNGAC
NNN- 3′
PsyIGACNNNGTC
GACN/NNGTC
CTGNN/NCAG
5′ - N
TelIGACNNNGTC
GACN/NNGTC
CTGNN/NCAG
5′ - N
TssIGAGNNNCTC
GAGNNNCTC
CTCNNNGAG
No Sequence Supplied
Asp700I GAANNNNTTC
GAANN/NNTTC
CTTNN/NNAAG
blunt
BoxIGACNNNNGTC
GACNN/NNGTC
CTGNN/NNCAG
blunt
Bse8IGATNNNNATC
GATNN/NNATC
CTANN/NNTAG
blunt
BseJIGATNNNNATC
GATNN/NNATC
CTANN/NNTAG
blunt
BsiBIGATNNNNATC
GATNN/NNATC
CTANN/NNTAG
blunt
BsrBRIGATNNNNATC
GATNN/NNATC
CTANN/NNTAG
blunt
BstPAIGACNNNNGTC
GACNN/NNGTC
CTGNN/NNCAG
blunt
CjeNIIGAGNNNNNGT
GAGNNNNNGT
CTCNNNNNCA
No Sequence Supplied
MamIGATNNNNATC
GATNN/NNATC
CTANN/NNTAG
blunt
MroXIGAANNNNTTC
GAANN/NNTTC
CTTNN/NNAAG
blunt
OliI CACNNNNGTG
CACNN/NNGTG
GTGNN/NNCAC
blunt
PdmI GAANNNNTTC
GAANN/NNTTC
CTTNN/NNAAG
blunt
RseICAYNNNNRTG
CAYNN/NNRTG
GTRNN/NNYAC
blunt
SmiMICAYNNNNRTG
CAYNN/NNRTG
GTRNN/NNYAC
blunt
UbaF12ICTACNNNGTC
CTACNNNGTC
GATGNNNCAG
No Sequence Supplied
AccB7I CCANNNNNTGG
CCANNNN/NTGG
GGTN/NNNNACC
NNN- 3′
AfiI CCNNNNNNNGG
CCNNNNN/NNGG
GGNN/NNNNNCC
NNN- 3′
ApaBIGCANNNNNTGC
GCANNNNN/TGC
CGT/NNNNNACG
NNNNN- 3′
AspEI GACNNNNNGTC
GACNNN/NNGTC
CTGNN/NNNCAG
N- 3′
BasI CCANNNNNTGG
CCANNNN/NTGG
GGTN/NNNNACC
NNN- 3′
BmeRIGACNNNNNGTC
GACNNN/NNGTC
CTGNN/NNNCAG
N- 3′
BplIGAGNNNNNCTC
NNNNN/NNNNNNNNGAGNNNNNCTCNNNNNNNNNNNNN/
/NNNNNNNNNNNNNCTCNNNNNGAGNNNNNNNN/NNNNN
NNNNN- 3′
Bsc4ICCNNNNNNNGG
CCNNNNN/NNGG
GGNN/NNNNNCC
NNN- 3′
BseLICCNNNNNNNGG
CCNNNNN/NNGG
GGNN/NNNNNCC
NNN- 3′
BsiYICCNNNNNNNGG
CCNNNNN/NNGG
GGNN/NNNNNCC
NNN- 3′
BstENICCTNNNNNAGG
CCTNN/NNNAGG
GGANNN/NNTCC
5′ - N
BstMWIGCNNNNNNNGC
GCNNNNN/NNGC
CGNN/NNNNNCG
NNN- 3′
CjeICCANNNNNNGT
NNNNNN/NNNNNNNNCCANNNNNNGTNNNNNNNNNNNNNNN/
/NNNNNNNNNNNNNNGGTNNNNNNCANNNNNNNNN/NNNNNN
NNNNNN- 3′
CjuICAYNNNNNRTG
CAYNNNNNRTG
GTRNNNNNYAC
No Sequence Supplied
CjuIICAYNNNNNCTC
CAYNNNNNCTC
GTRNNNNNGAG
No Sequence Supplied
DriIGACNNNNNGTC
GACNNN/NNGTC
CTGNN/NNNCAG
N- 3′
Eam1105IGACNNNNNGTC
GACNNN/NNGTC
CTGNN/NNNCAG
N- 3′
EclHKIGACNNNNNGTC
GACNNN/NNGTC
CTGNN/NNNCAG
N- 3′
FalIAAGNNNNNCTT
NNNNN/NNNNNNNNAAGNNNNNCTTNNNNNNNNNNNNN/
/NNNNNNNNNNNNNTTCNNNNNGAANNNNNNNN/NNNNN
NNNNN- 3′
HaeIVGAYNNNNNRTC
NNNNNN/NNNNNNNGAYNNNNNRTCNNNNNNNNNNNNNN/
/NNNNNNNNNNNNNCTRNNNNNYAGNNNNNNNNN/NNNNN
NNNNNN- 3′
Hin4IGAYNNNNNVTC
NNNNN/NNNNNNNNGAYNNNNNVTCNNNNNNNNNNNNN/
/NNNNNNNNNNNNNCTRNNNNNBAGNNNNNNNN/NNNNN
NNNNN- 3′
HpyF10VIGCNNNNNNNGC
GCNNNNN/NNGC
CGNN/NNNNNCG
NNN- 3′
NgoAVIIIGACNNNNNTGA
NN/NNNNNNNNNNNNGACNNNNNTGANNNNNNNNNNNNN/
/NNNNNNNNNNNNNNCTGNNNNNACTNNNNNNNNNNN/NN
NN- 3′
NruGI GACNNNNNGTC
GACNNN/NNGTC
CTGNN/NNNCAG
N- 3′
PflBI CCANNNNNTGG
CCANNNN/NTGG
GGTN/NNNNACC
NNN- 3′
SdeOSIGACNNNNRTGA
NN/NNNNNNNNNNNGACNNNNRTGANNNNNNNNNNNN/
/NNNNNNNNNNNNNCTGNNNNYACTNNNNNNNNNNNN
nick
UbaF14ICCANNNNNTCG
CCANNNNNTCG
GGTNNNNNAGC
No Sequence Supplied
Van91ICCANNNNNTGG
CCANNNN/NTGG
GGTN/NNNNACC
NNN- 3′
XagICCTNNNNNAGG
CCTNN/NNNAGG
GGANNN/NNTCC
5′ - N
AasI GACNNNNNNGTC
GACNNNN/NNGTC
CTGNN/NNNNCAG
NN- 3′
AlfIGCANNNNNNTGC
NN/NNNNNNNNNNGCANNNNNNTGCNNNNNNNNNNNN/
/NNNNNNNNNNNNCGTNNNNNNACGNNNNNNNNNN/NN
NN- 3′
BdaITGANNNNNNTCA
NN/NNNNNNNNNNTGANNNNNNTCANNNNNNNNNNNN/
/NNNNNNNNNNNNACTNNNNNNAGTNNNNNNNNNN/NN
NN- 3′
Bsp24IGACNNNNNNTGG
NNNNN/NNNNNNNNGACNNNNNNTGGNNNNNNNNNNNN/
/NNNNNNNNNNNNNCTGNNNNNNACCNNNNNNN/NNNNN
NNNNN- 3′
CjePICCANNNNNNNTC
NNNNNN/NNNNNNNCCANNNNNNNTCNNNNNNNNNNNNNN/
/NNNNNNNNNNNNNGGTNNNNNNNAGNNNNNNNN/NNNNNN
NNNNNN- 3′
DseDIGACNNNNNNGTC
GACNNNN/NNGTC
CTGNN/NNNNCAG
NN- 3′
HgiEIIACCNNNNNNGGT
ACCNNNNNNGGT
TGGNNNNNNCCA
No Sequence Supplied
PpiI GAACNNNNNCTC
NNNNN/NNNNNNNGAACNNNNNCTCNNNNNNNNNNNNN/
/NNNNNNNNNNNNCTTGNNNNNGAGNNNNNNNN/NNNNN
NNNNN- 3′
TstICACNNNNNNTCC
NNNNN/NNNNNNNNCACNNNNNNTCCNNNNNNNNNNNN/
/NNNNNNNNNNNNNGTGNNNNNNAGGNNNNNNN/NNNNN
NNNNN- 3′
UbaF9ITACNNNNNRTGT
TACNNNNNRTGT
ATGNNNNNYACA
No Sequence Supplied
AloI GAACNNNNNNTCC
NNNNN/NNNNNNNGAACNNNNNNTCCNNNNNNNNNNNN/
/NNNNNNNNNNNNCTTGNNNNNNAGGNNNNNNN/NNNNN
NNNNN- 3′
AlwFI GAAAYNNNNNRTG
GAAAYNNNNNRTG
CTTTRNNNNNYAC
No Sequence Supplied
ArsIGACNNNNNNTTYG
NNNNN/NNNNNNNNGACNNNNNNTTYGNNNNNNNNNNN/
/NNNNNNNNNNNNNCTGNNNNNNAARCNNNNNN/NNNNN
NNNNN- 3′
BarI GAAGNNNNNNTAC
NNNNN/NNNNNNNGAAGNNNNNNTACNNNNNNNNNNNN/
/NNNNNNNNNNNNCTTCNNNNNNATGNNNNNNN/NNNNN
NNNNN- 3′
CjeP659IVCACNNNNNNNGAA
CACNNNNNNNGAA
GTGNNNNNNNCTT
No Sequence Supplied
PcsIWCGNNNNNNNCGW
WCGNNNN/NNNCGW
WGCNNN/NNNNGCW
N- 3′
PsrIGAACNNNNNNTAC
NNNNN/NNNNNNNGAACNNNNNNTACNNNNNNNNNNNN/
/NNNNNNNNNNNNCTTGNNNNNNATGNNNNNNN/NNNNN
NNNNN- 3′
UbaF13IGAGNNNNNNCTGG
GAGNNNNNNCTGG
CTCNNNNNNGACC
No Sequence Supplied
AjuI GAANNNNNNNTTGG
NNNNN/NNNNNNNGAANNNNNNNTTGGNNNNNNNNNNN/
/NNNNNNNNNNNNCTTNNNNNNNAACCNNNNNN/NNNNN
NNNNN- 3′