Why Choose Recombinant Enzymes?

  • My NEB
  • Print
  • PDF
  • Established in 1975 as a private cooperative of experienced scientists, New England Biolabs is a world leader in the production of restriction endonucleases and related products for recombinant DNA technology. NEB has consistently maintained a position at the forefront of this field, and has successfully linked enzyme production efficiency to basic research in the cloning and overexpression of restriction/modification enzyme systems. This enables NEB to introduce substantial cuts in reagent costs and unsurpassed improvements in product quality and purity. Presently, NEB supplies more than 275 restriction enzymes, over 250 of which are available in recombinant form, as well as numerous recombinant polymerases and modifying enzymes for a wide variety of applications.

    Why choose a recombinant enzyme?

    Purity

    Once an enzyme system is cloned, choice of expression vector and strain background allows tight control over the production environment. For restriction endonucleases, this eliminates enzymes known to contaminate native preparations. For example, when producing AvrII (NEB #R0174) from the native strain Anabaena variabilis, great care must be taken to eliminate AvrI. Similarly, when producing HaeIII (NEB #R0108) from Haemophilus aegyptius, the enzyme must be purified free of HaeII (NEB #R0107). Choice of background strain also plays a key role in eliminating nonspecific endonucleases and exonucleases. Although recombinant enzymes and native enzymes are manufactured to meet the same rigorous quality control standards, it is recombinant enzymes that produce a more pure product with less processing time.

    Consistency

    Typically, the yields obtained for recombinant and overexpressed enzymes are significantly larger than those produced by native strains. Production of larger lots means greater product consistency and less lot-to-lot variation. Further, this large lot capability is ideal for customers that have a need for bulk quantities of enzymes. It simplifies their quality assurance procedures by reducing the time and effort normally spent to qualify enzymes supplied from different lots.

    Affordability

    At NEB, the introduction of recombinant enzymes has resulted in lower $/unit charges. Recombinant enzymes with lower $/unit cost allows our customers to experience substantial savings, while benefiting from improved purity and consistency of product.

    Advances

    Cloning does more than increase product quality and purity. There are many examples where native strains do not produce sufficient levels of desirable enzymes. For example, cloning of enzyme systems such as AvrII (NEB #R0174), BcgI (NEB #R0545), BspHI (NEB #R0517), HgaI (NEB #R0154), KasI (NEB #R0544), and NgoMIV (NEB #R0564) has led to these being commercially available. Also, recombinant enzymes are easier to manipulate at the genetic level often leading to the commercialization of new enzymes with useful biochemical properties. For example, the thermal stable enzyme VentR® DNA Polymerase has a 3´ - 5´ exonuclease. Cloning of the VentR® DNA Polymerase gene led to the production of an exo¯ version of the enzyme that is now widely preferred for DNA sequencing.

     Recombinant Enzymes From NEB:

    EnzymeSupplied NEBufferSequenceProperties
    AatIICutSmart™ BufferGACGT/C timesaver 5min
    AbaSI @25°CNEBuffer 4
    Acc65INEBuffer 3.1G/GTACC timesaver 5min dcm
    AccICutSmart™ BufferGT/MKAC timesaver 5min
    AciICutSmart™ BufferCCGC(-3/-1) timesaver 5min
    AclICutSmart™ BufferAA/CGTT timesaver 5min
    AcuICutSmart™ BufferCTGAAG(16/14) timesaver 5min sam
    AfeICutSmart™ BufferAGC/GCT
    AflIICutSmart™ BufferC/TTAAG timesaver 5min
    AflIIINEBuffer 3.1A/CRYGT
    AgeINEBuffer 1.1A/CCGGT
    AgeI-HFCutSmart™ BufferA/CCGGT timesaver 5min
    AgeI-HF® RE-Mix®Master Mix Reaction BufferA/CCGGT timesaver 5min
    AhdICutSmart™ BufferGACNNN/NNGTC timesaver 5min
    AleICutSmart™ BufferCACNN/NNGTG
    AluICutSmart™ BufferAG/CT timesaver 5min
    AlwICutSmart™ BufferGGATC(4/5) dam
    AlwNICutSmart™ BufferCAGNNN/CTG timesaver 5min dcm
    ApaI @25°CCutSmart™ BufferGGGCC/C timesaver 5min dcm
    ApaLICutSmart™ BufferG/TGCAC timesaver 5min
    ApeKI @75°CNEBuffer 3.1G/CWGC timesaver 5min
    ApoI @50°CNEBuffer 3.1R/AATTY timesaver 5min
    AscICutSmart™ BufferGG/CGCGCC timesaver 5min
    AscI RE-Mix®Master Mix Reaction BufferGG/CGCGCC timesaver 5min
    AseINEBuffer 3.1AT/TAAT timesaver 5min
    AsiSICutSmart™ BufferGCGAT/CGC
    AvaICutSmart™ BufferC/YCGRG timesaver 5min
    AvaIICutSmart™ BufferG/GWCC timesaver 5min dcm
    AvrIICutSmart™ BufferC/CTAGG timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    BamHINEBuffer 3.1G/GATCC timesaver 5min
    BamHI-HF®CutSmart™ BufferG/GATCC timesaver 5min
    BanICutSmart™ BufferG/GYRCC dcm
    BanIICutSmart™ BufferGRGCY/C
    BbvCICutSmart™ BufferCCTCAGC(-5/-2)
    BbvICutSmart™ BufferGCAGC(8/12) timesaver 5min
    BccICutSmart™ BufferCCATC(4/5)
    BceAINEBuffer 3.1ACGGC(12/14)
    BcgINEBuffer 3.1(10/12)CGANNNNNNTGC(12/10) dam sam
    BciVICutSmart™ BufferGTATCC(6/5) timesaver 5min
    BclI @50°CNEBuffer 3.1T/GATCA timesaver 5min dam
    BcoDICutSmart™ BufferGTCTC(1/5) timesaver 5min
    BfuAI @50°CNEBuffer 3.1ACCTGC(4/8) timesaver 5min
    BfuCICutSmart™ Buffer/GATC timesaver 5min
    BglINEBuffer 3.1GCCNNNN/NGGC timesaver 5min
    BglIINEBuffer 3.1A/GATCT timesaver 5min
    BlpICutSmart™ BufferGC/TNAGC timesaver 5min
    BmgBINEBuffer 3.1CACGTC(-3/-3) timesaver 5min
    BmrINEBuffer 2.1ACTGGG(5/4)
    BmtINEBuffer 3.1GCTAG/C
    BmtI-HF®CutSmart™ BufferGCTAG/C timesaver 5min
    BpmINEBuffer 3.1CTGGAG(16/14)
    Bpu10INEBuffer 3.1CCTNAGC(-5/-2)
    BpuEICutSmart™ BufferCTTGAG(16/14) timesaver 5min sam
    BsaAICutSmart™ BufferYAC/GTR timesaver 5min
    BsaHICutSmart™ BufferGR/CGYC timesaver 5min dcm
    BsaICutSmart™ BufferGGTCTC(1/5) dcm
    BsaI-HF®CutSmart™ BufferGGTCTC(1/5) timesaver 5min dcm
    BsaJI @60°CCutSmart™ BufferC/CNNGG
    BsaWI @60°CCutSmart™ BufferW/CCGGW timesaver 5min
    BseRICutSmart™ BufferGAGGAG(10/8) timesaver 5min
    BseYINEBuffer 3.1CCCAGC(-5/-1)
    BsgICutSmart™ BufferGTGCAG(16/14) timesaver 5min sam
    BsiWI @55°CNEBuffer 3.1C/GTACG timesaver 5min
    BslI @55°CCutSmart™ BufferCCNNNNN/NNGG timesaver 5min dcm
    BsmAI @55°CCutSmart™ BufferGTCTC(1/5) timesaver 5min
    BsmBI @55°CNEBuffer 3.1CGTCTC(1/5) timesaver 5min
    BsmFI @65°CCutSmart™ BufferGGGAC(10/14) dcm
    BsmI @65°CCutSmart™ BufferGAATGC(1/-1) timesaver 5min
    BsoBICutSmart™ BufferC/YCGRG timesaver 5min
    Bsp1286ICutSmart™ BufferGDGCH/C timesaver 5min
    BspCNI @25°CCutSmart™ BufferCTCAG(9/7) timesaver 5min sam
    BspDICutSmart™ BufferAT/CGAT dam
    BspEINEBuffer 3.1T/CCGGA timesaver 5min dam
    BspHICutSmart™ BufferT/CATGA timesaver 5min dam
    BspMINEBuffer 3.1ACCTGC(4/8)
    BspQI @50°CNEBuffer 3.1GCTCTTC(1/4) timesaver 5min
    BsrBICutSmart™ BufferCCGCTC(-3/-3) timesaver 5min
    BsrFICutSmart™ BufferR/CCGGY
    BsrGINEBuffer 2.1T/GTACA timesaver 5min
    BssHII @50°CCutSmart™ BufferG/CGCGC timesaver 5min
    BssKI @60°CCutSmart™ Buffer/CCNGG timesaver 5min dcm
    BssSINEBuffer 3.1CACGAG(-5/-1)
    BstAPI @60°CCutSmart™ BufferGCANNNN/NTGC
    BstBI @65°CCutSmart™ BufferTT/CGAA timesaver 5min
    BstEII  @60°CNEBuffer 3.1G/GTNACC timesaver 5min
    BstEII-HF®CutSmart™ BufferG/GTNACC timesaver 5min
    BstEII-HF® RE-Mix®Master Mix Reaction BufferG/GTNACC timesaver 5min
    BstNI @60°CNEBuffer 3.1CC/WGG timesaver 5min
    BstXINEBuffer 3.1CCANNNNN/NTGG timesaver 5min dcm
    BstYI @60°CNEBuffer 2.1R/GATCY timesaver 5min
    Bsu36ICutSmart™ BufferCC/TNAGG timesaver 5min
    BtgICutSmart™ BufferC/CRYGG timesaver 5min
    BtgZI @60°CCutSmart™ BufferGCGATG(10/14)
    BtsCI @50°CCutSmart™ BufferGGATG(2/0) timesaver 5min
    BtsI @55°CCutSmart™ BufferGCAGTG(2/0)
    BtsIMutI @55°CCutSmart™ BufferCAGTG(2/0)
    EnzymeBack to topSupplied NEBufferSequenceProperties
    ClaICutSmart™ BufferAT/CGAT timesaver 5min dam
    CspCICutSmart™ Buffer(11/13)CAANNNNNGTGG(12/10) timesaver 5min sam
    CviAII @25°CCutSmart™ BufferC/ATG timesaver 5min
    CviKI-1CutSmart™ BufferRG/CY
    CviQI @25°CNEBuffer 3.1G/TAC timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    DdeICutSmart™ BufferC/TNAG timesaver 5min
    DpnICutSmart™ BufferGA/TC timesaver 5min
    DpnIINEBuffer DpnII/GATC timesaver 5min dam
    DraICutSmart™ BufferTTT/AAA timesaver 5min
    DraIIINEBuffer 3CACNNN/GTG bsa
    DraIII-HF®CutSmart™ BufferCACNNN/GTG timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    EaeICutSmart™ BufferY/GGCCR dcm
    EagINEBuffer 3.1C/GGCCG timesaver 5min
    EagI-HF®CutSmart™ BufferC/GGCCG timesaver 5min
    EarICutSmart™ BufferCTCTTC(1/4) timesaver 5min
    EciICutSmart™ BufferGGCGGA(11/9)
    Eco53kICutSmart™ BufferGAG/CTC timesaver 5min
    EcoNICutSmart™ BufferCCTNN/NNNAGG timesaver 5min
    EcoO109ICutSmart™ BufferRG/GNCCY timesaver 5min dcm
    EcoP15INEBuffer 3.1CAGCAG(25/27) timesaver 5min
    EcoRINEBuffer EcoRIG/AATTC timesaver 5min
    EcoRI-HF®CutSmart™ BufferG/AATTC timesaver 5min
    EcoRI-HF® RE-Mix®Master Mix Reaction BufferG/AATTC timesaver 5min
    EcoRVNEBuffer 3.1GAT/ATC timesaver 5min
    EcoRV-HF®CutSmart™ BufferGAT/ATC timesaver 5min
    EcoRV-HF® RE-Mix®Master Mix Reaction BufferGAT/ATC timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    FatI @55°CNEBuffer 2.1/CATG
    FauI @55°CCutSmart™ BufferCCCGC(4/6)
    Fnu4HICutSmart™ BufferGC/NGC timesaver 5min
    FokICutSmart™ BufferGGATG(9/13) dcm
    FseICutSmart™ BufferGGCCGG/CC timesaver 5min dcm
    FspEINEBuffer 4CC(12/16) bsa
    FspICutSmart™ BufferTGC/GCA timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    HaeIICutSmart™ BufferRGCGC/Y timesaver 5min
    HaeIIICutSmart™ BufferGG/CC timesaver 5min
    HgaINEBuffer 1.1GACGC(5/10)
    HhaICutSmart™ BufferGCG/C timesaver 5min
    HincIINEBuffer 3.1GTY/RAC timesaver 5min
    HindIIINEBuffer 2.1A/AGCTT
    HindIII-HF®CutSmart™ BufferA/AGCTT timesaver 5min
    HinfICutSmart™ BufferG/ANTC timesaver 5min
    HinP1ICutSmart™ BufferG/CGC timesaver 5min
    HpaICutSmart™ BufferGTT/AAC
    HpaIICutSmart™ BufferC/CGG timesaver 5min
    HphICutSmart™ BufferGGTGA(8/7) timesaver 5min dam
    Hpy166IICutSmart™ BufferGTN/NAC timesaver 5min
    Hpy188ICutSmart™ BufferTCN/GA dam
    Hpy188IIICutSmart™ BufferTC/NNGA dam
    Hpy99ICutSmart™ BufferCGWCG/
    HpyAVCutSmart™ BufferCCTTC(6/5) timesaver 5min
    HpyCH4IIICutSmart™ BufferACN/GT
    HpyCH4IVCutSmart™ BufferA/CGT timesaver 5min
    HpyCH4VCutSmart™ BufferTG/CA timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    I-CeuICutSmart™ BufferTAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
    I-SceICutSmart™ BufferTAGGGATAACAGGGTAAT(-9/-13)
    EnzymeBack to topSupplied NEBufferSequenceProperties
    KasICutSmart™ BufferG/GCGCC
    KpnINEBuffer 1.1GGTAC/C
    KpnI-HF®CutSmart™ BufferGGTAC/C timesaver 5min
    KpnI-HF® RE-Mix®Master Mix Reaction BufferGGTAC/C timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    LpnPINEBuffer 4CCDG(10/14) bsa
    EnzymeBack to topSupplied NEBufferSequenceProperties
    MboICutSmart™ Buffer/GATC timesaver 5min dam
    MboIICutSmart™ BufferGAAGA(8/7) dam
    MfeICutSmart™ BufferC/AATTG
    MfeI-HF®CutSmart™ BufferC/AATTG timesaver 5min
    MfeI-HF® RE-Mix®Master Mix Reaction BufferC/AATTG timesaver 5min
    MluCICutSmart™ Buffer/AATT timesaver 5min
    MluINEBuffer 3.1A/CGCGT timesaver 5min
    MlyICutSmart™ BufferGAGTC(5/5) timesaver 5min
    MmeICutSmart™ BufferTCCRAC(20/18) timesaver 5min sam
    MnlICutSmart™ BufferCCTC(7/6) timesaver 5min
    MscICutSmart™ BufferTGG/CCA dcm
    MseICutSmart™ BufferT/TAA timesaver 5min
    MslICutSmart™ BufferCAYNN/NNRTG timesaver 5min
    MspA1ICutSmart™ BufferCMG/CKG timesaver 5min
    MspICutSmart™ BufferC/CGG timesaver 5min
    MspJINEBuffer 4CNNR(9/13) bsa
    MwoI @60°CCutSmart™ BufferGCNNNNN/NNGC timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    NaeICutSmart™ BufferGCC/GGC
    NarICutSmart™ BufferGG/CGCC
    Nb.BbvCICutSmart™ BufferCCTCAGC
    Nb.BsmI @65°CNEBuffer 3.1GAATGC
    Nb.BsrDI @65°CCutSmart™ BufferGCAATG
    Nb.BtsICutSmart™ BufferGCAGTG
    NciICutSmart™ BufferCC/SGG timesaver 5min
    NcoINEBuffer 3.1C/CATGG timesaver 5min
    NcoI-HF®CutSmart™ BufferC/CATGG timesaver 5min
    NcoI-HF® RE-Mix®Master Mix Reaction BufferC/CATGG timesaver 5min
    NdeICutSmart™ BufferCA/TATG timesaver 5min
    NgoMIVCutSmart™ BufferG/CCGGC timesaver 5min
    NheINEBuffer 2.1G/CTAGC timesaver 5min
    NheI-HF®CutSmart™ BufferG/CTAGC timesaver 5min
    NheI-HF® RE-Mix®Master Mix Reaction BufferG/CTAGC timesaver 5min
    NlaIIICutSmart™ BufferCATG/ timesaver 5min
    NlaIVCutSmart™ BufferGGN/NCC dcm
    NmeAIIICutSmart™ BufferGCCGAG(21/19) sam
    NotINEBuffer 3.1GC/GGCCGC timesaver 5min
    NotI-HF®CutSmart™ BufferGC/GGCCGC timesaver 5min
    NotI-HF® RE-Mix® Master Mix Reaction BufferGC/GGCCGC timesaver 5min
    NruINEBuffer 3.1TCG/CGA timesaver 5min dam
    NsiINEBuffer 3.1ATGCA/T timesaver 5min
    NspICutSmart™ BufferRCATG/Y timesaver 5min
    Nt.AlwICutSmart™ BufferGGATC(4/-5) dam
    Nt.BbvCICutSmart™ BufferCCTCAGC(-5/-7)
    Nt.BsmAICutSmart™ BufferGTCTC(1/-5)
    Nt.BspQI @50°CNEBuffer 3.1GCTCTTC(1/-7)
    Nt.BstNBI @55°CNEBuffer 3.1GAGTC(4/-5)
    Nt.CviPIICutSmart™ Buffer(0/-1)CCD
    EnzymeBack to topSupplied NEBufferSequenceProperties
    PacICutSmart™ BufferTTAAT/TAA timesaver 5min
    PacI RE-Mix®Master Mix Reaction BufferTTAAT/TAA timesaver 5min
    PaeR7ICutSmart™ BufferC/TCGAG timesaver 5min
    PciINEBuffer 3.1A/CATGT
    PflMINEBuffer 3.1CCANNNN/NTGG timesaver 5min dcm
    PhoI @75°CCutSmart™ BufferGG/CC dcm
    PI-PspI @65°CNEBuffer PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) bsa
    PI-SceINEBuffer PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) bsa
    PleICutSmart™ BufferGAGTC(4/5)
    PluTICutSmart™ BufferGGCGC/C
    PmeICutSmart™ BufferGTTT/AAAC timesaver 5min
    PpuMICutSmart™ BufferRG/GWCCY timesaver 5min dcm
    PshAICutSmart™ BufferGACNN/NNGTC timesaver 5min
    PsiICutSmart™ BufferTTA/TAA
    PspGI @75°CCutSmart™ Buffer/CCWGG dcm
    PspOMICutSmart™ BufferG/GGCCC dcm
    PspXICutSmart™ BufferVC/TCGAGB
    PstINEBuffer 3.1CTGCA/G timesaver 5min
    PstI-HF®CutSmart™ BufferCTGCA/G timesaver 5min
    PvuINEBuffer 3.1CGAT/CG timesaver 5min
    PvuI-HF®CutSmart™ BufferCGAT/CG timesaver 5min
    PvuIINEBuffer 3.1CAG/CTG timesaver 5min
    PvuII-HF®CutSmart™ BufferCAG/CTG timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    RsaICutSmart™ BufferGT/AC timesaver 5min
    RsrIICutSmart™ BufferCG/GWCCG
    EnzymeBack to topSupplied NEBufferSequenceProperties
    SacINEBuffer 1.1GAGCT/C timesaver 5min
    SacI-HF®CutSmart™ BufferGAGCT/C timesaver 5min
    SacIICutSmart™ BufferCCGC/GG timesaver 5min
    SalINEBuffer 3.1G/TCGAC timesaver 5min
    SalI-HF®CutSmart™ BufferG/TCGAC timesaver 5min
    SalI-HF® RE-Mix®Master Mix Reaction BufferG/TCGAC timesaver 5min
    SapICutSmart™ BufferGCTCTTC(1/4) timesaver 5min
    Sau3AINEBuffer 1.1/GATC
    Sau96ICutSmart™ BufferG/GNCC dcm
    SbfICutSmart™ BufferCCTGCA/GG timesaver 5min
    SbfI-HF®CutSmart™ BufferCCTGCA/GG timesaver 5min
    ScaINEBuffer 3AGT/ACT
    ScaI-HF®CutSmart™ BufferAGT/ACT timesaver 5min
    ScaI-HF® RE-Mix®Master Mix Reaction BufferAGT/ACT timesaver 5min
    ScrFICutSmart™ BufferCC/NGG dcm
    SexAICutSmart™ BufferA/CCWGGT dcm
    SfaNINEBuffer 3.1GCATC(5/9)
    SfcICutSmart™ BufferC/TRYAG
    SfiI @50°CCutSmart™ BufferGGCCNNNN/NGGCC timesaver 5min dcm
    SfoICutSmart™ BufferGGC/GCC timesaver 5min dcm
    SgrAICutSmart™ BufferCR/CCGGYG
    SmaI @25°CCutSmart™ BufferCCC/GGG timesaver 5min
    SmlI @55°CCutSmart™ BufferC/TYRAG
    SnaBICutSmart™ BufferTAC/GTA
    SpeICutSmart™ BufferA/CTAGT timesaver 5min
    SpeI RE-Mix®Master Mix Reaction BufferA/CTAGT timesaver 5min
    SpeI-HF®CutSmart™ BufferA/CTAGT timesaver 5min
    SphI-HF®CutSmart™ BufferGCATG/C timesaver 5min
    SphINEBuffer 2.1GCATG/C
    SspINEBuffer SspIAAT/ATT timesaver 5min
    SspI-HF®CutSmart™ BufferAAT/ATT timesaver 5min
    StuICutSmart™ BufferAGG/CCT timesaver 5min dcm
    StyD4ICutSmart™ Buffer/CCNGG timesaver 5min dcm
    StyINEBuffer 3.1C/CWWGG timesaver 5min
    StyI-HF®CutSmart™ BufferC/CWWGG timesaver 5min
    SwaI @25°CNEBuffer 3.1ATTT/AAAT timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    TaqαI @65°CCutSmart™ BufferT/CGA timesaver 5min dam
    TfiI @65°CCutSmart™ BufferG/AWTC timesaver 5min
    TliI @75°CNEBuffer 3C/TCGAG bsa
    TspRI @65°CCutSmart™ BufferNNCASTGNN/ timesaver 5min
    Tth111I @65°CCutSmart™ BufferGACN/NNGTC timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    XbaICutSmart™ BufferT/CTAGA timesaver 5min dam
    XbaI RE-Mix®Master Mix Reaction BufferT/CTAGA timesaver 5min dam
    XcmINEBuffer 2.1CCANNNNN/NNNNTGG
    XhoICutSmart™ BufferC/TCGAG timesaver 5min
    XhoI RE-Mix®Master Mix Reaction BufferC/TCGAG timesaver 5min
    XmaICutSmart™ BufferC/CCGGG timesaver 5min
    XmnICutSmart™ BufferGAANN/NNTTC timesaver 5min
    EnzymeBack to topSupplied NEBufferSequenceProperties
    ZraICutSmart™ BufferGAC/GTC