New England Biolabs: Reagents for the Life Sciences Industry

Isoschizomers

Restriction endonucleases that recognize the same sequence are isoschizomers. The first example discovered is called a prototype and all subsequent enzymes that recognize the same sequence are isoschizomers of the prototype. The list below contains isoschizomers for commercially available restriction endonucleases. It also specifies which isoschizomer is available from New England Biolabs.

All recognition sequences are written 5´ to 3´ using the single letter code nomenclature with the point of cleavage indicated by a "/".

Numbers in parentheses indicate point of cleavage for non-palindromic enzymes. For example, GGTCTC(1/5) indicates cleavage at:
5´ ...GGTCTCN/...3´
3´ ...CCAGAGNNNNN/...5´

Isoschizomers with alternative cleavage sites are indicated with a " ^ ". Enzymes that are not currently commercially available are indicated with a " x ".

Neoschizomers are a subset of isoschizomers that recognize the same sequence, but cleave at different positions from the prototype. Thus, AatII (recognition sequence: GACGT↓C) and ZraI (recognition sequence: GAC↓GTC) are neoschizomers of one another, while HpaII (recognition sequence: C↓CGG) and MspI (recognition sequence: C↓CGG) are isoschizomers. Analogous designations are not appropriate for MTases, where the differences between enzymes are not so easily defined and usually have not been well characterized.


(1)
A HF version of this enzyme is available.
(2) A RE-Mix version of this enzyme is available.

EnzymeSequenceNEB EnzymeCatalog NumberCut SiteOther Isoschizomers
AanI TTA/TAAPsiIR0657TTA/TAAPsiI
AarI CACCTGC(4/8)
AasI GACNNNN/NNGTCDrdIR0530GACNNNN/NNGTCDrdI, DseDI
AatI AGG/CCTStuIR0187AGG/CCTEco147I, PceI , SseBI, StuI
AatIIGACGT/CAatIIR0117GACGT/CZraI^
ZraI^R0659GAC/GTC
AauI T/GTACABsrGI §R0575T/GTACABsp1407I, BsrGI, BstAUI, SspBI
AbsI CC/TCGAGG
Acc113I AGT/ACTScaI §R0122AGT/ACTAssI , BmcAI^, ScaI, ZrmI
Acc16I TGC/GCAFspIR0135TGC/GCAAviII , FspI, MstI, NsbI
Acc36I ACCTGC(4/8)BfuAIR0701ACCTGC(4/8)BfuAI, BspMI, BveI
BspMIR0502ACCTGC(4/8)
Acc65IG/GTACCAcc65IR0599G/GTACCAsp718I , KpnI^
KpnI^ §R0142GGTAC/C
AccB1I G/GYRCCBanIR0118G/GYRCCBanI, BshNI, BspT107I, HgiCI
AccB7I CCANNNN/NTGGPflMIR0509CCANNNN/NTGGBasI , PflBI , PflMI, Van91I
AccBSI CCGCTC(-3/-3)BsrBIR0102CCGCTC(-3/-3)BsrBI, MbiI
AccIGT/MKACAccIR0161GT/MKACFblI, XmiI
AccII CG/CGBstUIR0518CG/CGBsh1236I, BspFNI^, BstFNI, BstUI, FnuDII^, MvnI, ThaI
AccIIIT/CCGGABspEIR0540T/CCGGAAor13HI , BlfI , BseAI, BsiMI, Bsp13I, BspEI, BspMII, Kpn2I , MroI
AceIII xCAGCTC(7/11)
AciICCGC(-3/-1)AciIR0551CCGC(-3/-1)BspACI, SsiI
AclIAA/CGTTAclIR0598AA/CGTTPsp1406I
AclWI GGATC(4/5)AlwIR0513GGATC(4/5)AlwI, BinI, BspPI, Nt.AlwI^
Nt.AlwI^R0627GGATC(4/-5)
AcoI Y/GGCCREaeIR0508Y/GGCCRCfrI, EaeI
AcsI R/AATTYApoI §R0566R/AATTYApoI, XapI
AcuICTGAAG(16/14)AcuIR0641CTGAAG(16/14)Eco57I
AcvI CAC/GTGPmlIR0532CAC/GTGBbrPI , Eco72I, PmaCI , PmlI, PspCI
AcyI GR/CGYCBsaHIR0556GR/CGYCBsaHI, BssNI, BstACI, Hin1I, Hsp92I
AdeI CACNNN/GTGDraIII §R0510CACNNN/GTGDraIII
AfaI GT/ACCviQI^R0639G/TACCsp6I^, CviQI^, RsaI
RsaIR0167GT/AC
AfeIAGC/GCTAfeIR0652AGC/GCTAor51HI , Eco47III, FunI
AfiI CCNNNNN/NNGGBslIR0555CCNNNNN/NNGGBsc4I, BseLI, BsiYI, BslI
AflI G/GWCCAvaIIR0153G/GWCCAvaII, Bme18I, Eco47I, PspO3I^, SinI, Vpak11AI^
AflIIC/TTAAGAflIIR0520C/TTAAGBfrI , BspTI, Bst98I, BstAFI, MspCI, Vha464I
AflIIIA/CRYGTAflIIIR0541A/CRYGT
AgeIA/CCGGTAgeI §R0552A/CCGGTAsiAI , BshTI, CspAI, PinAI
AgsITTS/AA
AhaIII xTTT/AAADraI^R0129TTT/AAADraI^
AhdIGACNNN/NNGTCAhdIR0584GACNNN/NNGTCAspEI , BmeRI, DriI, Eam1105I, EclHKI, NruGI
AhlI A/CTAGTSpeI §R0133A/CTAGTBcuI , SpeI
AjiI CACGTC(-3/-3)BmgBIR0628CACGTC(-3/-3)BmgBI, BtrI^
AjnI /CCWGGBstNI^R0168CC/WGGBciT130I^, BptI^, BseBI^, BsiLI^, Bst2UI^, BstNI^, BstOI^, EcoRII^, MvaI^, Psp6I ^, PspGI^
PspGI^R0611/CCWGG
AjuI (7/12)GAANNNNNNNTTGG(11/6)
AleICACNN/NNGTGAleIR0634CACNN/NNGTGOliI
AlfI(10/12)GCANNNNNNTGC(12/10)
AloI (7/12)GAACNNNNNNTCC(12/7)
AluBI AG/CT
AluIAG/CTAluIR0137AG/CT
Alw21I GWGCW/CBsiHKAIR0570GWGCW/CAspHI , Bbv12I , BsiHKAI, HgiAI
Alw26I GTCTC(1/5)BcoDIR0542GTCTC(1/5)BcoDI, BsmAI, BsoMAI, BstMAI, Nt.BsmAI^
BsmAIR0529GTCTC(1/5)
Nt.BsmAI^R0121GTCTC(1/-5)
Alw44I G/TGCACApaLIR0507G/TGCACApaLI, VneI
AlwFI xGAAAYNNNNNRTG
AlwIGGATC(4/5)AlwIR0513GGATC(4/5)AclWI , BinI, BspPI, Nt.AlwI^
Nt.AlwI^R0627GGATC(4/-5)
AlwNICAGNNN/CTGAlwNIR0514CAGNNN/CTGCaiI, PstNI
Ama87I C/YCGRGAvaIR0152C/YCGRGAvaI, BcoI , BmeT110I, BsiHKCI, BsoBI, Eco88I, NspIII
BsoBIR0586C/YCGRG
AocI CC/TNAGGBsu36IR0524CC/TNAGGAxyI , Bse21I, Bsu36I, CvnI, Eco81I, SauI
Aor13HI T/CCGGABspEIR0540T/CCGGAAccIII, BlfI , BseAI, BsiMI, Bsp13I, BspEI, BspMII, Kpn2I , MroI
Aor51HI AGC/GCTAfeIR0652AGC/GCTAfeI, Eco47III, FunI
AoxIx/GGCCHaeIII^R0108GG/CCBshFI ^, BsnI^, BspANI^, BsuRI^, HaeIII^, PalI ^, PhoI^
PhoI^R0705GG/CC
ApaBIxGCANNNNN/TGCBstAPI^R0654GCANNNN/NTGCBstAPI^
ApaIGGGCC/CApaIR0114GGGCC/CBsp120I^, PspOMI^
PspOMI^R0653G/GGCCC
ApaLIG/TGCACApaLIR0507G/TGCACAlw44I , VneI
ApeKIG/CWGCApeKIR0643G/CWGCTseI
TseIR0591G/CWGC
ApoIR/AATTYApoI §R0566R/AATTYAcsI , XapI
ApyPIxATCGAC(20/18)
AquIIxGCCGNAC(20/18)
AquIVxGRGGAAG(19/17)
ArsI(8/13)GACNNNNNNTTYG(11/6)
AscIGG/CGCGCCAscIR0558GG/CGCGCCPalAI , SgsI
AseIAT/TAATAseIR0526AT/TAATAsnI , PshBI , VspI
AsiAI A/CCGGTAgeI §R0552A/CCGGTAgeI, BshTI, CspAI, PinAI
AsiGI A/CCGGTAgeI §R0552A/CCGGTAgeI, AsiAI , BshTI, CspAI, PinAI
AsiSIGCGAT/CGCAsiSIR0630GCGAT/CGCRgaI, SfaAI, SgfI
AsnI AT/TAATAseIR0526AT/TAATAseI, PshBI , VspI
Asp700I GAANN/NNTTCXmnIR0194GAANN/NNTTCMroXI, PdmI , XmnI
Asp718I G/GTACCAcc65IR0599G/GTACCAcc65I, KpnI^
KpnI^ §R0142GGTAC/C
AspA2I C/CTAGGAvrIIR0174C/CTAGGAvrII, BlnI , BspA2I, XmaJI
AspBHIxYSCNS(8/12)
AspCNI xGCCGC
AspEI GACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, BmeRI, DriI, Eam1105I, EclHKI, NruGI
AspHI GWGCW/CBsiHKAIR0570GWGCW/CAlw21I , Bbv12I , BsiHKAI, HgiAI
AspI GACN/NNGTCPflFIR0595GACN/NNGTCPflFI, PsyI, TelI, Tth111I
Tth111IR0185GACN/NNGTC
AspLEI GCG/CHhaIR0139GCG/CBstHHI, CfoI, GlaI^, HhaI, R9529^, HinP1I^, HspAI ^
HinP1I^R0124G/CGC
AspS9I G/GNCCSau96IR0165G/GNCCAsuI , BmgT120I^, BsiZI, Cfr13I, FmuI^, PspPI , Sau96I, UnbI^
AssI xAGT/ACTScaI §R0122AGT/ACTAcc113I , BmcAI^, ScaI, ZrmI
Asu14238IVCGTRAC
AsuC2I CC/SGGNciIR0196CC/SGGBcnI , BpuMI, CauII, EcoHI^, NciI
AsuHPI GGTGA(8/7)HphIR0158GGTGA(8/7)HphI
AsuI xG/GNCCSau96IR0165G/GNCCAspS9I , BmgT120I^, BsiZI, Cfr13I, FmuI^, PspPI , Sau96I, UnbI^
AsuII TT/CGAABstBIR0519TT/CGAABpu14I, BsiCI, Bsp119I, BspT104I, BstBI, Csp45I, NspV , SfuI
AsuNHI G/CTAGCBmtI^ §R0658GCTAG/CBmtI^, BspOI^, NheI
NheI §R0131G/CTAGC
AvaIC/YCGRGAvaIR0152C/YCGRGAma87I , BcoI , BmeT110I, BsiHKCI, BsoBI, Eco88I, NspIII
BsoBIR0586C/YCGRG
AvaIIG/GWCCAvaIIR0153G/GWCCAflI , Bme18I, Eco47I, PspO3I^, SinI, Vpak11AI^
AvaIII xATGCATNsiI^ §R0127ATGCA/TBfrBl^, EcoT22I^, Mph1103I^, NsiI^, Zsp2I^
AviII TGC/GCAFspIR0135TGC/GCAAcc16I , FspI, MstI, NsbI
AvrIIC/CTAGGAvrIIR0174C/CTAGGAspA2I , BlnI , BspA2I, XmaJI
Awo1030IVGCCRAG
AxyI CC/TNAGGBsu36IR0524CC/TNAGGAocI , Bse21I, Bsu36I, CvnI, Eco81I, SauI
BaeGIGKGCM/CBaeGIR0708GKGCM/CBseSI, BstSLI
BaeI(10/15)ACNNNNGTAYC(12/7)BaeIR0613(10/15)ACNNNNGTAYC(12/7)
BalI TGG/CCAMscIR0534TGG/CCAMlsI, MluNI, MscI, Msp20I
BamHIG/GATCCBamHI §R0136G/GATCC
BanIG/GYRCCBanIR0118G/GYRCCAccB1I , BshNI, BspT107I, HgiCI
BanIIGRGCY/CBanIIR0119GRGCY/CEco24I, EcoT38I, FriOI, HgiJII
BanIII AT/CGATBspDIR0557AT/CGATBsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
ClaIR0197AT/CGAT
BanLIRTCAGG
BarI (7/12)GAAGNNNNNNTAC(12/7)
BasI xCCANNNN/NTGGPflMIR0509CCANNNN/NTGGAccB7I , PflBI , PflMI, Van91I
BauI CACGAG(-5/-1)BssSαIR0680CACGAG(-5/-1)BsiI, BssSαI, Bst2BI, Nb.BssSI^
Nb.BssSI^R0681CACGAG
BbeI GGCGC/CKasI^R0544G/GCGCCDinI^, EgeI^, KasI^, Mly113I^, NarI^, PluTI, SfoI^, SspDI^
NarI^R0191GG/CGCC
PluTIR0713GGCGC/C
SfoI^R0606GGC/GCC
BbrPI CAC/GTGPmlIR0532CAC/GTGAcvI , Eco72I, PmaCI , PmlI, PspCI
BbsIGAAGAC(2/6)BbsIR0539GAAGAC(2/6)BbvII , BpiI, BpuAI, BstV2I
BbuI GCATG/CSphI §R0182GCATG/CPaeI , SpaHI, SphI
Bbv12I GWGCW/CBsiHKAIR0570GWGCW/CAlw21I , AspHI , BsiHKAI, HgiAI
BbvCICCTCAGC(-5/-2)BbvCIR0601CCTCAGC(-5/-2)Nb.BbvCI^, Nt.BbvCI^
Nb.BbvCI^R0631CCTCAGC
Nt.BbvCI^R0632CCTCAGC(-5/-7)
BbvIGCAGC(8/12)BbvIR0173GCAGC(8/12)BseXI, Bst71I, BstV1I, Lsp1109I
BbvII xGAAGAC(2/6)BbsIR0539GAAGAC(2/6)BbsI, BpiI, BpuAI, BstV2I
BccICCATC(4/5)BccIR0704CCATC(4/5)
Bce83I xCTTGAG(16/14)BpuEIR0633CTTGAG(16/14)BpuEI
BceAIACGGC(12/14)BceAIR0623ACGGC(12/14)
BcefI xACGGC(12/13)
BcgI(10/12)CGANNNNNNTGC(12/10)BcgIR0545(10/12)CGANNNNNNTGC(12/10)
BciT130ICC/WGGBstNIR0168CC/WGGAjnI ^, BptI, BseBI, BsiLI, Bst2UI, BstNI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
PspGI^R0611/CCWGG
BciVIGTATCC(6/5)BciVIR0596GTATCC(6/5)BfuI , BsuI
BclIT/GATCABclIR0160T/GATCABsiQI, FbaI, Ksp22I
BcnI CC/SGGNciIR0196CC/SGGAsuC2I , BpuMI, CauII, EcoHI^, NciI
BcoDIGTCTC(1/5)BcoDIR0542GTCTC(1/5)Alw26I , BsmAI, BsoMAI, BstMAI, Nt.BsmAI^
BsmAIR0529GTCTC(1/5)
Nt.BsmAI^R0121GTCTC(1/-5)
BcoI C/YCGRGAvaIR0152C/YCGRGAma87I , AvaI, BmeT110I, BsiHKCI, BsoBI, Eco88I, NspIII
BsoBIR0586C/YCGRG
BcuI A/CTAGTSpeI §R0133A/CTAGTAhlI , SpeI
BdaIx(10/12)TGANNNNNNTCA(12/10)
BetI xW/CCGGWBsaWIR0567W/CCGGWBsaWI
BfaIC/TAGBfaIR0568C/TAGFspBI, MaeI, XspI
BfaSIIGANGGAG
BfiI xACTGGG(5/4)BmrIR0600ACTGGG(5/4)BmrI, BmuI
BfmI C/TRYAGSfcIR0561C/TRYAGBpcI, BstSFI, SfcI
BfoIRGCGC/YHaeIIR0107RGCGC/YBsp143II, BstH2I, HaeII
BfrBlxATGCA/TNsiI §R0127ATGCA/TAvaIII ^, EcoT22I, Mph1103I, NsiI, Zsp2I
BfrI C/TTAAGAflIIR0520C/TTAAGAflII, BspTI, Bst98I, BstAFI, MspCI, Vha464I
BfuAIACCTGC(4/8)BfuAIR0701ACCTGC(4/8)Acc36I , BspMI, BveI
BspMIR0502ACCTGC(4/8)
BfuCI/GATCBfuCIR0636/GATCBscFI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
DpnI^R0176GA/TC
MboIR0147/GATC
Sau3AIR0169/GATC
BfuI GTATCC(6/5)BciVIR0596GTATCC(6/5)BciVI, BsuI
BglIGCCNNNN/NGGCBglIR0143GCCNNNN/NGGC
BglIIA/GATCTBglIIR0144A/GATCT
BinIxGGATC(4/5)AlwIR0513GGATC(4/5)AclWI , AlwI, BspPI, Nt.AlwI^
Nt.AlwI^R0627GGATC(4/-5)
BisI GC/NGCFnu4HIR0178GC/NGCBlsI ^, BthCI^, Fnu4HI, Fsp4HI, GluI, ItaI , SatI
BlfI T/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BseAI, BsiMI, Bsp13I, BspEI, BspMII, Kpn2I , MroI
BlnI C/CTAGGAvrIIR0174C/CTAGGAspA2I , AvrII, BspA2I, XmaJI
BlpIGC/TNAGCBlpIR0585GC/TNAGCBpu1102I, Bsp1720I, CelII, EspI
BlsI GCN/GCFnu4HI^R0178GC/NGCBisI ^, BthCI^, Fnu4HI^, Fsp4HI^, GluI^, ItaI ^, SatI^
BmcAIAGT/ACTScaI^ §R0122AGT/ACTAcc113I ^, AssI ^, ScaI^, ZrmI^
Bme1390ICC/NGGBssKI^R0592/CCNGGBmrFI, BssKI^, BstSCI^, MspR9I, ScrFI, StyD4I^
ScrFIR0110CC/NGG
StyD4I^R0638/CCNGG
Bme18IG/GWCCAvaIIR0153G/GWCCAflI , AvaII, Eco47I, PspO3I^, SinI, Vpak11AI^
BmeRIGACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, AspEI , DriI, Eam1105I, EclHKI, NruGI
BmeT110IC/YCGRGAvaIR0152C/YCGRGAma87I , AvaI, BcoI , BsiHKCI, BsoBI, Eco88I, NspIII
BsoBIR0586C/YCGRG
BmgBICACGTC(-3/-3)BmgBIR0628CACGTC(-3/-3)AjiI , BtrI^
BmgIxGKGCCC
BmgT120IGG/NCCSau96I^R0165G/GNCCAspS9I ^, AsuI ^, BsiZI^, Cfr13I^, FmuI^, PspPI ^, Sau96I^, UnbI^
BmiIGGN/NCCNlaIVR0126GGN/NCCBscBI, BspLI, NlaIV, PspN4I
BmrFICC/NGGBssKI^R0592/CCNGGBme1390I, BssKI^, BstSCI^, MspR9I, ScrFI, StyD4I^
ScrFIR0110CC/NGG
StyD4I^R0638/CCNGG
BmrIACTGGG(5/4)BmrIR0600ACTGGG(5/4)BfiI , BmuI
BmsIGCATC(5/9)SfaNIR0172GCATC(5/9)LweI, SfaNI
BmtIGCTAG/CBmtI §R0658GCTAG/CAsuNHI ^, BspOI, NheI^
NheI^ §R0131G/CTAGC
BmuIACTGGG(5/4)BmrIR0600ACTGGG(5/4)BfiI , BmrI
BmyIGDGCH/CBsp1286IR0120GDGCH/CBsp1286I, MhlI, SduI
BoxIGACNN/NNGTCPshAIR0593GACNN/NNGTCBstPAI, PshAI
BpcIC/TRYAGSfcIR0561C/TRYAGBfmI , BstSFI, SfcI
BpiIGAAGAC(2/6)BbsIR0539GAAGAC(2/6)BbsI, BbvII , BpuAI, BstV2I
BplI(8/13)GAGNNNNNCTC(13/8)
BpmICTGGAG(16/14)BpmIR0565CTGGAG(16/14)GsuI
BptICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BseBI, BsiLI, Bst2UI, BstNI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
PspGI^R0611/CCWGG
Bpu10ICCTNAGC(-5/-2)Bpu10IR0649CCTNAGC(-5/-2)
Bpu1102IGC/TNAGCBlpIR0585GC/TNAGCBlpI, Bsp1720I, CelII, EspI
Bpu14ITT/CGAABstBIR0519TT/CGAAAsuII , BsiCI, Bsp119I, BspT104I, BstBI, Csp45I, NspV , SfuI
BpuAIGAAGAC(2/6)BbsIR0539GAAGAC(2/6)BbsI, BbvII , BpiI, BstV2I
BpuEICTTGAG(16/14)BpuEIR0633CTTGAG(16/14)Bce83I
BpuMICC/SGGNciIR0196CC/SGGAsuC2I , BcnI , CauII, EcoHI^, NciI
BpvUIxCGAT/CGPvuI §R0150CGAT/CGBspCI, MvrI, Ple19I , PvuI
Bsa29IAT/CGATBspDIR0557AT/CGATBanIII , BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
ClaIR0197AT/CGAT
BsaAIYAC/GTRBsaAIR0531YAC/GTRBstBAI, Ppu21I
BsaBIGATNN/NNATCBsaBIR0537GATNN/NNATCBse8I, BseJI, BsiBI, BsrBRI, MamI
BsaHIGR/CGYCBsaHIR0556GR/CGYCAcyI , BssNI, BstACI, Hin1I, Hsp92I
BsaIGGTCTC(1/5)BsaI §R0535GGTCTC(1/5)Bso31I, BspTNI, Eco31I
BsaJIC/CNNGGBsaJIR0536C/CNNGGBseDI, BssECI, SecI
BsaMIGAATGC(1/-1)BsmIR0134GAATGC(1/-1)BscCI, BsmI, Mva1269I, Nb.BsmI^, PctI
Nb.BsmI^R0706GAATGC
BsaOICGRY/CGBsiEIR0554CGRY/CGBsh1285I , BsiEI, BstMCI, McrI
BsaWIW/CCGGWBsaWIR0567W/CCGGWBetI
BsaXI(9/12)ACNNNNNCTCC(10/7)BsaXIR0609(9/12)ACNNNNNCTCC(10/7)
BsbIxCAACAC(21/19)
Bsc4ICCNNNNN/NNGGBslIR0555CCNNNNN/NNGGAfiI , BseLI, BsiYI, BslI
BscBIGGN/NCCNlaIVR0126GGN/NCCBmiI, BspLI, NlaIV, PspN4I
BscCIGAATGC(1/-1)BsmIR0134GAATGC(1/-1)BsaMI, BsmI, Mva1269I, Nb.BsmI^, PctI
Nb.BsmI^R0706GAATGC
BscFI/GATCBfuCIR0636/GATCBfuCI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
DpnI^R0176GA/TC
MboIR0147/GATC
Sau3AIR0169/GATC
BscGIxCCCGT
Bse118IR/CCGGYBsrFαIR0682R/CCGGYBsrFαI, BssAI, Cfr10I
Bse1IACTGG(1/-1)BsrIR0527ACTGG(1/-1)BseNI, BsrI
Bse21ICC/TNAGGBsu36IR0524CC/TNAGGAocI , AxyI , Bsu36I, CvnI, Eco81I, SauI
Bse3DIGCAATG(2/0)BsrDIR0574GCAATG(2/0)BseMI, BsrDI, Nb.BsrDI^
Nb.BsrDI^R0648GCAATG
Bse8IGATNN/NNATCBsaBIR0537GATNN/NNATCBsaBI, BseJI, BsiBI, BsrBRI, MamI
BseAIT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BsiMI, Bsp13I, BspEI, BspMII, Kpn2I , MroI
BseBICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BsiLI, Bst2UI, BstNI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
PspGI^R0611/CCWGG
BseCIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
ClaIR0197AT/CGAT
BseDIC/CNNGGBsaJIR0536C/CNNGGBsaJI, BssECI, SecI
BseGIGGATG(2/0)BtsCIR0647GGATG(2/0)BstF5I, BtsCI, FokI^
FokI^R0109GGATG(9/13)
BseJIGATNN/NNATCBsaBIR0537GATNN/NNATCBsaBI, Bse8I, BsiBI, BsrBRI, MamI
BseLICCNNNNN/NNGGBslIR0555CCNNNNN/NNGGAfiI , Bsc4I, BsiYI, BslI
BseMIGCAATG(2/0)BsrDIR0574GCAATG(2/0)Bse3DI, BsrDI, Nb.BsrDI^
Nb.BsrDI^R0648GCAATG
BseMIICTCAG(10/8)BspCNI^R0624CTCAG(9/7)BspCNI^
BseNIACTGG(1/-1)BsrIR0527ACTGG(1/-1)Bse1I, BsrI
BsePIG/CGCGCBssHIIR0199G/CGCGCBssHII, PauI , PteI
BseRIGAGGAG(10/8)BseRIR0581GAGGAG(10/8)
BseSIGKGCM/CBaeGIR0708GKGCM/CBaeGI, BstSLI
BseX3I C/GGCCGEagI §R0505C/GGCCGBstZI, EagI, EclXI, Eco52I, XmaIII
BseXIGCAGC(8/12)BbvIR0173GCAGC(8/12)BbvI, Bst71I, BstV1I, Lsp1109I
BseYICCCAGC(-5/-1)BseYIR0635CCCAGC(-5/-1)GsaI^
BsgIGTGCAG(16/14)BsgIR0559GTGCAG(16/14)
Bsh1236ICG/CGBstUIR0518CG/CGAccII , BspFNI^, BstFNI, BstUI, FnuDII^, MvnI, ThaI
Bsh1285I CGRY/CGBsiEIR0554CGRY/CGBsaOI, BsiEI, BstMCI, McrI
BshFI GG/CCHaeIIIR0108GG/CCAoxI^, BsnI, BspANI, BsuRI, HaeIII, PalI , PhoI
PhoIR0705GG/CC
BshI GG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BsnI, BspANI, BsuRI, HaeIII, PalI , PhoI
PhoIR0705GG/CC
BshNIG/GYRCCBanIR0118G/GYRCCAccB1I , BanI, BspT107I, HgiCI
BshTIA/CCGGTAgeI §R0552A/CCGGTAgeI, AsiAI , CspAI, PinAI
BshVIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
ClaIR0197AT/CGAT
BsiBIGATNN/NNATCBsaBIR0537GATNN/NNATCBsaBI, Bse8I, BseJI, BsrBRI, MamI
BsiCITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, Bsp119I, BspT104I, BstBI, Csp45I, NspV , SfuI
BsiEICGRY/CGBsiEIR0554CGRY/CGBsaOI, Bsh1285I , BstMCI, McrI
BsiHKAIGWGCW/CBsiHKAIR0570GWGCW/CAlw21I , AspHI , Bbv12I , HgiAI
BsiHKCIC/YCGRGAvaIR0152C/YCGRGAma87I , AvaI, BcoI , BmeT110I, BsoBI, Eco88I, NspIII
BsoBIR0586C/YCGRG
BsiIxCACGAG(-5/-1)BssSαIR0680CACGAG(-5/-1)BauI , BssSαI, Bst2BI, Nb.BssSI^
Nb.BssSI^R0681CACGAG
BsiLICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BseBI, Bst2UI, BstNI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
PspGI^R0611/CCWGG
BsiMIT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, Bsp13I, BspEI, BspMII, Kpn2I , MroI
BsiQIT/GATCABclIR0160T/GATCABclI, FbaI, Ksp22I
BsiSIC/CGGHpaIIR0171C/CGGHapII, HpaII, MspI
MspIR0106C/CGG
BsiWIC/GTACGBsiWIR0553C/GTACGPfl23II , PspLI , SplI, SunI
BsiXIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
ClaIR0197AT/CGAT
BsiYIxCCNNNNN/NNGGBslIR0555CCNNNNN/NNGGAfiI , Bsc4I, BseLI, BslI
BsiZIG/GNCCSau96IR0165G/GNCCAspS9I , AsuI , BmgT120I^, Cfr13I, FmuI^, PspPI , Sau96I, UnbI^
BslFIGGGAC(10/14)BsmFIR0572GGGAC(10/14)BsmFI, FaqI, FinI^
BslICCNNNNN/NNGGBslIR0555CCNNNNN/NNGGAfiI , Bsc4I, BseLI, BsiYI
BsmAIGTCTC(1/5)BsmAIR0529GTCTC(1/5)Alw26I , BcoDI, BsoMAI, BstMAI, Nt.BsmAI^
BcoDIR0542GTCTC(1/5)
Nt.BsmAI^R0121GTCTC(1/-5)
BsmBICGTCTC(1/5)BsmBIR0580CGTCTC(1/5)Esp3I
BsmFIGGGAC(10/14)BsmFIR0572GGGAC(10/14)BslFI, FaqI, FinI^
BsmIGAATGC(1/-1)BsmIR0134GAATGC(1/-1)BsaMI, BscCI, Mva1269I, Nb.BsmI^, PctI
Nb.BsmI^R0706GAATGC
BsnIGG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BspANI, BsuRI, HaeIII, PalI , PhoI
PhoIR0705GG/CC
Bso31IGGTCTC(1/5)BsaI §R0535GGTCTC(1/5)BsaI, BspTNI, Eco31I
BsoBIC/YCGRGBsoBIR0586C/YCGRGAma87I , AvaI, BcoI , BmeT110I, BsiHKCI, Eco88I, NspIII
AvaIR0152C/YCGRG
BsoMAIGTCTC(1/5)BcoDIR0542GTCTC(1/5)Alw26I , BcoDI, BsmAI, BstMAI, Nt.BsmAI^
BsmAIR0529GTCTC(1/5)
Nt.BsmAI^R0121GTCTC(1/-5)
Bsp106IAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, BspDI, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
ClaIR0197AT/CGAT
Bsp119ITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, BspT104I, BstBI, Csp45I, NspV , SfuI
Bsp120IG/GGCCCApaI^R0114GGGCC/CApaI^, PspOMI
PspOMIR0653G/GGCCC
Bsp1286IGDGCH/CBsp1286IR0120GDGCH/CBmyI, MhlI, SduI
Bsp13IT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, BsiMI, BspEI, BspMII, Kpn2I , MroI
Bsp1407IT/GTACABsrGI §R0575T/GTACAAauI , BsrGI, BstAUI, SspBI
Bsp143I/GATCBfuCIR0636/GATCBfuCI, BscFI, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
DpnI^R0176GA/TC
MboIR0147/GATC
Sau3AIR0169/GATC
Bsp143IIRGCGC/YHaeIIR0107RGCGC/YBfoI, BstH2I, HaeII
Bsp1720IGC/TNAGCBlpIR0585GC/TNAGCBlpI, Bpu1102I, CelII, EspI
Bsp19IC/CATGGNcoI §R0193C/CATGGNcoI
Bsp24Ix(8/13)GACNNNNNNTGG(12/7)
Bsp68ITCG/CGANruI §R0192TCG/CGABtuMI, NruI, RruI^
BspA2IC/CTAGGAvrIIR0174C/CTAGGAspA2I , AvrII, BlnI , XmaJI
BspACICCGC(-3/-1)AciIR0551CCGC(-3/-1)AciI, SsiI
BspANIGG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BsnI, BsuRI, HaeIII, PalI , PhoI
PhoIR0705GG/CC
BspCICGAT/CGPvuI §R0150CGAT/CGBpvUI, MvrI, Ple19I , PvuI
BspCNICTCAG(9/7)BspCNIR0624CTCAG(9/7)BseMII^
BspDIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspXI, Bsu15I, BsuTUI, ClaI, ZhoI
ClaIR0197AT/CGAT
BspEIT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, BsiMI, Bsp13I, BspMII, Kpn2I , MroI
BspFNICG/CGBstUI^R0518CG/CGAccII ^, Bsh1236I^, BstFNI^, BstUI^, FnuDII, MvnI^, ThaI^
BspGIxCTGGAC
BspHIT/CATGABspHIR0517T/CATGACciI, PagI , RcaI
BspLIGGN/NCCNlaIVR0126GGN/NCCBmiI, BscBI, NlaIV, PspN4I
BspLU11IxA/CATGTPciIR0655A/CATGTPciI, PscI
BspMAI CTGCA/GPstI §R0140CTGCA/GPstI
BspMIACCTGC(4/8)BspMIR0502ACCTGC(4/8)Acc36I , BfuAI, BveI
BfuAIR0701ACCTGC(4/8)
BspMIIxT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, BsiMI, Bsp13I, BspEI, Kpn2I , MroI
BspNCIxCCAGA
BspOIGCTAG/CBmtI §R0658GCTAG/CAsuNHI ^, BmtI, NheI^
NheI^ §R0131G/CTAGC
BspPIGGATC(4/5)AlwIR0513GGATC(4/5)AclWI , AlwI, BinI, Nt.AlwI^
Nt.AlwI^R0627GGATC(4/-5)
BspQIGCTCTTC(1/4)BspQIR0712GCTCTTC(1/4)LguI, Nt.BspQI^, PciSI , SapI
Nt.BspQI^R0644GCTCTTC(1/-7)
SapIR0569GCTCTTC(1/4)
BspT104ITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, Bsp119I, BstBI, Csp45I, NspV , SfuI
BspT107IG/GYRCCBanIR0118G/GYRCCAccB1I , BanI, BshNI, HgiCI
BspTIC/TTAAGAflIIR0520C/TTAAGAflII, BfrI , Bst98I, BstAFI, MspCI, Vha464I
BspTNIGGTCTC(1/5)BsaI §R0535GGTCTC(1/5)BsaI, Bso31I, Eco31I
BspUIxGCSG/C
BspXIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, Bsu15I, BsuTUI, ClaI, ZhoI
ClaIR0197AT/CGAT
BsrBICCGCTC(-3/-3)BsrBIR0102CCGCTC(-3/-3)AccBSI , MbiI
BsrBRIGATNN/NNATCBsaBIR0537GATNN/NNATCBsaBI, Bse8I, BseJI, BsiBI, MamI
BsrDIGCAATG(2/0)BsrDIR0574GCAATG(2/0)Bse3DI, BseMI, Nb.BsrDI^
Nb.BsrDI^R0648GCAATG
BsrFαIR/CCGGYBsrFαIR0682R/CCGGYBse118I, BssAI, Cfr10I
BsrFIR/CCGGYBsrFIR0562R/CCGGYBse118I, BsrFαI, BssAI, Cfr10I
BsrGIT/GTACABsrGI §R0575T/GTACAAauI , Bsp1407I, BstAUI, SspBI
BsrIACTGG(1/-1)BsrIR0527ACTGG(1/-1)Bse1I, BseNI
BsrSIACTGG(1/-1)BsrIR0527ACTGG(1/-1)Bse1I, BseNI, BsrI
BssAIR/CCGGYBsrFαIR0682R/CCGGYBse118I, BsrFαI, Cfr10I
BssECIC/CNNGGBsaJIR0536C/CNNGGBsaJI, BseDI, SecI
BssHIC/TCGAGPaeR7IR0177C/TCGAGPaeR7I, Sfr274I, SlaI, StrI, TliI, XhoI
TliIR0612C/TCGAG
XhoIR0146C/TCGAG
BssHIIG/CGCGCBssHIIR0199G/CGCGCBsePI, PauI , PteI
BssKI/CCNGGBssKIR0592/CCNGGBme1390I^, BmrFI^, BstSCI, MspR9I^, ScrFI^, StyD4I
ScrFI^R0110CC/NGG
StyD4IR0638/CCNGG
BssMI/GATCBfuCIR0636/GATCBfuCI, BscFI, Bsp143I, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
DpnI^R0176GA/TC
MboIR0147/GATC
Sau3AIR0169/GATC
BssNAIGTA/TACBstZ17IR0594GTA/TACBst1107I, BstZ17I, SnaI^
BssNIGR/CGYCBsaHIR0556GR/CGYCAcyI , BsaHI, BstACI, Hin1I, Hsp92I
BssSαICACGAG(-5/-1)BssSαIR0680CACGAG(-5/-1)BauI , BsiI, Bst2BI, Nb.BssSI^
Nb.BssSI^R0681CACGAG
BssSICACGAG(-5/-1)BssSIR0587CACGAG(-5/-1)BauI , BsiI, BssSαI, Bst2BI, Nb.BssSI^
Nb.BssSI^R0681CACGAG
BssT1IC/CWWGGStyI §R0500C/CWWGGEco130I, EcoT14I, ErhI , StyI
Bst1107IGTA/TACBstZ17IR0594GTA/TACBssNAI, BstZ17I, SnaI^
Bst2BICACGAG(-5/-1)BssSαIR0680CACGAG(-5/-1)BauI , BsiI, BssSαI, Nb.BssSI^
Nb.BssSI^R0681CACGAG
Bst2UICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BseBI, BsiLI, BstNI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
PspGI^R0611/CCWGG
Bst4CIACN/GTHpyCH4IIIR0618ACN/GTHpyCH4III, TaaI, Tsp4CI
Bst6ICTCTTC(1/4)EarIR0528CTCTTC(1/4)Eam1104I, EarI, Ksp632I
Bst71IxGCAGC(8/12)BbvIR0173GCAGC(8/12)BbvI, BseXI, BstV1I, Lsp1109I
Bst98IC/TTAAGAflIIR0520C/TTAAGAflII, BfrI , BspTI, BstAFI, MspCI, Vha464I
BstACIGR/CGYCBsaHIR0556GR/CGYCAcyI , BsaHI, BssNI, Hin1I, Hsp92I
BstAFIC/TTAAGAflIIR0520C/TTAAGAflII, BfrI , BspTI, Bst98I, MspCI, Vha464I
BstAPIGCANNNN/NTGCBstAPIR0654GCANNNN/NTGCApaBI^
BstAUIT/GTACABsrGI §R0575T/GTACAAauI , Bsp1407I, BsrGI, SspBI
BstBAIYAC/GTRBsaAIR0531YAC/GTRBsaAI, Ppu21I
BstBITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, Bsp119I, BspT104I, Csp45I, NspV , SfuI
BstC8IGCN/NGCCac8IR0579GCN/NGCCac8I
BstDEIC/TNAGDdeIR0175C/TNAGDdeI, HpyF3I
BstDSIC/CRYGGBtgIR0608C/CRYGGBtgI, DsaI
BstEII G/GTNACCBstEII  §R0162G/GTNACCBstPI, Eco065I, Eco91I, EcoO65I, PspEI
BstENICCTNN/NNNAGGEcoNIR0521CCTNN/NNNAGGEcoNI, XagI
BstENII/GATCBfuCIR0636/GATCBfuCI, BscFI, Bsp143I, BssMI, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
DpnI^R0176GA/TC
MboIR0147/GATC
Sau3AIR0169/GATC
BstF5IGGATG(2/0)BtsCIR0647GGATG(2/0)BseGI, BtsCI, FokI^
FokI^R0109GGATG(9/13)
BstFNICG/CGBstUIR0518CG/CGAccII , Bsh1236I, BspFNI^, BstUI, FnuDII^, MvnI, ThaI
BstH2IRGCGC/YHaeIIR0107RGCGC/YBfoI, Bsp143II, HaeII
BstHHIGCG/CHhaIR0139GCG/CAspLEI , CfoI, GlaI^, HhaI, R9529^, HinP1I^, HspAI ^
HinP1I^R0124G/CGC
BstHPIGTT/AACHpaIR0105GTT/AACHpaI, KspAI
BstKTIGAT/CBfuCI^R0636/GATCBfuCI^, BscFI^, Bsp143I^, BssMI^, BstENII^, BstMBI^, DpnI^, Kzo9I^, MalI^, MboI^, NdeII^, Sau3AI^
DpnI^R0176GA/TC
MboI^R0147/GATC
Sau3AI^R0169/GATC
BstMAIGTCTC(1/5)BcoDIR0542GTCTC(1/5)Alw26I , BcoDI, BsmAI, BsoMAI, Nt.BsmAI^
BsmAIR0529GTCTC(1/5)
Nt.BsmAI^R0121GTCTC(1/-5)
BstMBI/GATCBfuCIR0636/GATCBfuCI, BscFI, Bsp143I, BssMI, BstENII, BstKTI^, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
DpnI^R0176GA/TC
MboIR0147/GATC
Sau3AIR0169/GATC
BstMCICGRY/CGBsiEIR0554CGRY/CGBsaOI, Bsh1285I , BsiEI, McrI
BstMWIGCNNNNN/NNGCMwoIR0573GCNNNNN/NNGCHpyF10VI, MwoI
BstNICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BseBI, BsiLI, Bst2UI, BstOI, EcoRII^, MvaI, Psp6I ^, PspGI^
PspGI^R0611/CCWGG
BstNSIRCATG/YNspIR0602RCATG/YNspI, XceI
BstOICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BseBI, BsiLI, Bst2UI, BstNI, EcoRII^, MvaI, Psp6I ^, PspGI^
PspGI^R0611/CCWGG
BstPAIGACNN/NNGTCPshAIR0593GACNN/NNGTCBoxI, PshAI
BstPIG/GTNACCBstEII  §R0162G/GTNACCBstEII , Eco065I, Eco91I, EcoO65I, PspEI
BstSCI/CCNGGBssKIR0592/CCNGGBme1390I^, BmrFI^, BssKI, MspR9I^, ScrFI^, StyD4I
ScrFI^R0110CC/NGG
StyD4IR0638/CCNGG
BstSFIC/TRYAGSfcIR0561C/TRYAGBfmI , BpcI, SfcI
BstSLIGKGCM/CBaeGIR0708GKGCM/CBaeGI, BseSI
BstSNITAC/GTASnaBIR0130TAC/GTAEco105I, SnaBI
BstUICG/CGBstUIR0518CG/CGAccII , Bsh1236I, BspFNI^, BstFNI, FnuDII^, MvnI, ThaI
BstV1IGCAGC(8/12)BbvIR0173GCAGC(8/12)BbvI, BseXI, Bst71I, Lsp1109I
BstV2IGAAGAC(2/6)BbsIR0539GAAGAC(2/6)BbsI, BbvII , BpiI, BpuAI
BstX2IR/GATCYBstYIR0523R/GATCYBstYI, MflI, PsuI, XhoII
BstXICCANNNNN/NTGGBstXIR0113CCANNNNN/NTGG
BstYIR/GATCYBstYIR0523R/GATCYBstX2I, MflI, PsuI, XhoII
BstZ17IGTA/TACBstZ17IR0594GTA/TACBssNAI, Bst1107I, SnaI^
BstZIC/GGCCGEagI §R0505C/GGCCGBseX3I , EagI, EclXI, Eco52I, XmaIII
Bsu15IAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, BsuTUI, ClaI, ZhoI
ClaIR0197AT/CGAT
Bsu36ICC/TNAGGBsu36IR0524CC/TNAGGAocI , AxyI , Bse21I, CvnI, Eco81I, SauI
BsuIGTATCC(6/5)BciVIR0596GTATCC(6/5)BciVI, BfuI
BsuRIGG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BsnI, BspANI, HaeIII, PalI , PhoI
PhoIR0705GG/CC
BsuTUIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, ClaI, ZhoI
ClaIR0197AT/CGAT
BtgIC/CRYGGBtgIR0608C/CRYGGBstDSI, DsaI
BtgZIGCGATG(10/14)BtgZIR0703GCGATG(10/14)
BthCIxGCNG/CFnu4HI^R0178GC/NGCBisI ^, BlsI ^, Fnu4HI^, Fsp4HI^, GluI^, ItaI ^, SatI^
BtrICACGTC(-3/-3)BmgBI^R0628CACGTC(-3/-3)AjiI ^, BmgBI^
BtsαIGCAGTG(2/0)BtsαIR0667GCAGTG(2/0)BtsI, Nb.BtsI^
BtsIR0614GCAGTG(2/0)
Nb.BtsI^R0707GCAGTG
BtsCIGGATG(2/0)BtsCIR0647GGATG(2/0)BseGI, BstF5I, FokI^
FokI^R0109GGATG(9/13)
BtsIGCAGTG(2/0)BtsIR0614GCAGTG(2/0)BtsαI, Nb.BtsI^
BtsαIR0667GCAGTG(2/0)
Nb.BtsI^R0707GCAGTG
BtsIMutICAGTG(2/0)BtsIMutIR0664CAGTG(2/0)
BtuMITCG/CGANruI §R0192TCG/CGABsp68I, NruI, RruI^
BveIACCTGC(4/8)BfuAIR0701ACCTGC(4/8)Acc36I , BfuAI, BspMI
BspMIR0502ACCTGC(4/8)
Cac8IGCN/NGCCac8IR0579GCN/NGCBstC8I
CaiICAGNNN/CTGAlwNIR0514CAGNNN/CTGAlwNI, PstNI
CauIIxCC/SGGNciIR0196CC/SGGAsuC2I , BcnI , BpuMI, EcoHI^, NciI
CchIIxGGARGA(11/9)
CchIIIxCCCAAG(20/18)
CciIT/CATGABspHIR0517T/CATGABspHI, PagI , RcaI
CciNIGC/GGCCGCNotI §R0189GC/GGCCGCNotI
CcrNAIIICGACCAG
CdiIxCATCG(-1/-1)
CdpIGCGGAG(20/18)
CelIIGC/TNAGCBlpIR0585GC/TNAGCBlpI, Bpu1102I, Bsp1720I, EspI
CfoIGCG/CHhaIR0139GCG/CAspLEI , BstHHI, GlaI^, HhaI, R9529^, HinP1I^, HspAI ^
HinP1I^R0124G/CGC
Cfr10IR/CCGGYBsrFαIR0682R/CCGGYBse118I, BsrFαI, BssAI
Cfr13IG/GNCCSau96IR0165G/GNCCAspS9I , AsuI , BmgT120I^, BsiZI, FmuI^, PspPI , Sau96I, UnbI^
Cfr42ICCGC/GGSacIIR0157CCGC/GGKspI, SacII, Sfr303I, SgrBI, SstII
Cfr9IC/CCGGGSmaI^R0141CCC/GGGPspAI , SmaI^, TspMI, XmaCI
TspMIR0709C/CCGGG
CfrIxY/GGCCREaeIR0508Y/GGCCRAcoI , EaeI
Cgl13032IGGCGCA
Cgl13032IIACGABGG
CjeFIIIxGCAAGG
CjeFVxGGRCA
CjeIx(8/14)CCANNNNNNGT(15/9)
CjeNIIxGAGNNNNNGT
CjeNIIIxGKAAYG(19/17)
CjeP659IVxCACNNNNNNNGAA
CjePIx(7/13)CCANNNNNNNTC(14/8)
CjuIxCAYNNNNNRTG
CjuIIxCAYNNNNNCTC
ClaIAT/CGATClaIR0197AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ZhoI
BspDIR0557AT/CGAT
Cly7489IIAAAACRG
CpoICG/GWCCG
CseIGACGC(5/10)HgaIR0154GACGC(5/10)HgaI
CsiIA/CCWGGTSexAIR0605A/CCWGGTMabI, SexAI
Csp45ITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, Bsp119I, BspT104I, BstBI, NspV , SfuI
Csp6IG/TACCviQIR0639G/TACAfaI ^, CviQI, RsaI^
RsaI^R0167GT/AC
CspAIA/CCGGTAgeI §R0552A/CCGGTAgeI, AsiAI , BshTI, PinAI
CspCI(11/13)CAANNNNNGTGG(12/10)CspCIR0645(11/13)CAANNNNNGTGG(12/10)
CspICG/GWCCG
CstMIxAAGGAG(20/18)
CviAIIC/ATGCviAIIR0640C/ATGFaeI^, FatI^, Hin1II^, Hsp92II ^, NlaIII^
FatI^R0650/CATG
NlaIII^R0125CATG/
CviJIRG/CY
CviKI-1RG/CYCviKI-1R0710RG/CYCviJI^, CviTI^
CviQIG/TACCviQIR0639G/TACAfaI ^, Csp6I, RsaI^
RsaI^R0167GT/AC
CviRIxTG/CAHpyCH4VR0620TG/CAHpyCH4V
CviTIRG/CY
CvnICC/TNAGGBsu36IR0524CC/TNAGGAocI , AxyI , Bse21I, Bsu36I, Eco81I, SauI
DdeIC/TNAGDdeIR0175C/TNAGBstDEI, HpyF3I
DinIGGC/GCCKasI^R0544G/GCGCCBbeI ^, EgeI, KasI^, Mly113I^, NarI^, PluTI^, SfoI, SspDI^
NarI^R0191GG/CGCC
PluTI^R0713GGCGC/C
SfoIR0606GGC/GCC
DpnIGA/TCDpnIR0176GA/TCBfuCI^, BscFI^, Bsp143I^, BssMI^, BstENII^, BstKTI^, BstMBI^, Kzo9I^, MalI^, MboI^, NdeII^, Sau3AI^
BfuCI^R0636/GATC
MboI^R0147/GATC
Sau3AI^R0169/GATC
DpnII/GATCDpnIIR0543/GATCBfuCI, BscFI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^, Sau3AI
DpnI^R0176GA/TC
MboIR0147/GATC
Sau3AIR0169/GATC
DraITTT/AAADraIR0129TTT/AAAAhaIII ^
DraIIRG/GNCCYEcoO109IR0503RG/GNCCYEcoO109I, PssI^
DraIIICACNNN/GTGDraIII §R0510CACNNN/GTGAdeI
DraRIxCAAGNAC(20/18)
DrdIGACNNNN/NNGTCDrdIR0530GACNNNN/NNGTCAasI , DseDI
DrdIIxGAACCA
DriIGACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, AspEI , BmeRI, Eam1105I, EclHKI, NruGI
DsaIxC/CRYGGBtgIR0608C/CRYGGBstDSI, BtgI
DseDIGACNNNN/NNGTCDrdIR0530GACNNNN/NNGTCAasI , DrdI
DvuIIIxCACNCAC
EaeIY/GGCCREaeIR0508Y/GGCCRAcoI , CfrI
EagIC/GGCCGEagI §R0505C/GGCCGBseX3I , BstZI, EclXI, Eco52I, XmaIII
Eam1104ICTCTTC(1/4)EarIR0528CTCTTC(1/4)Bst6I, EarI, Ksp632I
Eam1105IGACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, AspEI , BmeRI, DriI, EclHKI, NruGI
EarICTCTTC(1/4)EarIR0528CTCTTC(1/4)Bst6I, Eam1104I, Ksp632I
EciIGGCGGA(11/9)EciIR0590GGCGGA(11/9)
Ecl136IIGAG/CTCEco53kIR0116GAG/CTCEco53kI, EcoICRI, Psp124BI ^, SacI^, SstI^
SacI^ §R0156GAGCT/C
EclHKIGACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, AspEI , BmeRI, DriI, Eam1105I, NruGI
EclXIC/GGCCGEagI §R0505C/GGCCGBseX3I , BstZI, EagI, Eco52I, XmaIII
Eco065IG/GTNACCBstEII  §R0162G/GTNACCBstEII , BstPI, Eco91I, EcoO65I, PspEI
Eco105ITAC/GTASnaBIR0130TAC/GTABstSNI, SnaBI
Eco130IC/CWWGGStyI §R0500C/CWWGGBssT1I, EcoT14I, ErhI , StyI
Eco147IAGG/CCTStuIR0187AGG/CCTAatI , PceI , SseBI, StuI
Eco24IGRGCY/CBanIIR0119GRGCY/CBanII, EcoT38I, FriOI, HgiJII
Eco31IGGTCTC(1/5)BsaI §R0535GGTCTC(1/5)BsaI, Bso31I, BspTNI
Eco32IGAT/ATCEcoRV §R0195GAT/ATCEcoRV
Eco47IG/GWCCAvaIIR0153G/GWCCAflI , AvaII, Bme18I, PspO3I^, SinI, Vpak11AI^
Eco47IIIAGC/GCTAfeIR0652AGC/GCTAfeI, Aor51HI , FunI
Eco52IC/GGCCGEagI §R0505C/GGCCGBseX3I , BstZI, EagI, EclXI, XmaIII
Eco53kIGAG/CTCEco53kIR0116GAG/CTCEcl136II, EcoICRI, Psp124BI ^, SacI^, SstI^
SacI^ §R0156GAGCT/C
Eco57ICTGAAG(16/14)AcuIR0641CTGAAG(16/14)AcuI
Eco57MIxCTGRAG(16/14)
Eco72ICAC/GTGPmlIR0532CAC/GTGAcvI , BbrPI , PmaCI , PmlI, PspCI
Eco81ICC/TNAGGBsu36IR0524CC/TNAGGAocI , AxyI , Bse21I, Bsu36I, CvnI, SauI
Eco88IC/YCGRGAvaIR0152C/YCGRGAma87I , AvaI, BcoI , BmeT110I, BsiHKCI, BsoBI, NspIII
BsoBIR0586C/YCGRG
Eco91IG/GTNACCBstEII  §R0162G/GTNACCBstEII , BstPI, Eco065I, EcoO65I, PspEI
EcoHIx/CCSGGNciI^R0196CC/SGGAsuC2I ^, BcnI ^, BpuMI^, CauII^, NciI^
EcoICRIGAG/CTCEco53kIR0116GAG/CTCEcl136II, Eco53kI, Psp124BI ^, SacI^, SstI^
SacI^ §R0156GAGCT/C
EcoNICCTNN/NNNAGGEcoNIR0521CCTNN/NNNAGGBstENI, XagI
EcoO109IRG/GNCCYEcoO109IR0503RG/GNCCYDraII, PssI^
EcoO65IG/GTNACCBstEII  §R0162G/GTNACCBstEII , BstPI, Eco065I, Eco91I, PspEI
EcoP15ICAGCAG(25/27)EcoP15IR0646CAGCAG(25/27)
EcoRIG/AATTCEcoRI §R0101G/AATTCFunII
EcoRII/CCWGGBstNI^R0168CC/WGGAjnI ^, BciT130I^, BptI^, BseBI^, BsiLI^, Bst2UI^, BstNI^, BstOI^, MvaI^, Psp6I , PspGI
PspGIR0611/CCWGG
EcoRVGAT/ATCEcoRV §R0195GAT/ATCEco32I
EcoT14IC/CWWGGStyI §R0500C/CWWGGBssT1I, Eco130I, ErhI , StyI
EcoT22IATGCA/TNsiI §R0127ATGCA/TAvaIII ^, BfrBl, Mph1103I, NsiI, Zsp2I
EcoT38IGRGCY/CBanIIR0119GRGCY/CBanII, Eco24I, FriOI, HgiJII
EgeIGGC/GCCKasI^R0544G/GCGCCBbeI ^, DinI, KasI^, Mly113I^, NarI^, PluTI^, SfoI, SspDI^
NarI^R0191GG/CGCC
PluTI^R0713GGCGC/C
SfoIR0606GGC/GCC
EheIGGC/GCCKasI^R0544G/GCGCCBbeI ^, DinI, EgeI, KasI^, Mly113I^, NarI^, PluTI^, SfoI, SspDI^
NarI^R0191GG/CGCC
PluTI^R0713GGCGC/C
SfoIR0606GGC/GCC
ErhI C/CWWGGStyI §R0500C/CWWGGBssT1I, Eco130I, EcoT14I, StyI
EsaSSIxGACCAC
Esp3ICGTCTC(1/5)BsmBIR0580CGTCTC(1/5)BsmBI
EspIxGC/TNAGCBlpIR0585GC/TNAGCBlpI, Bpu1102I, Bsp1720I, CelII
FaeICATG/CviAII^R0640C/ATGCviAII^, FatI^, Hin1II, Hsp92II , NlaIII
FatI^R0650/CATG
NlaIIIR0125CATG/
FaiIYA/TR
FalI(8/13)AAGNNNNNCTT(13/8)
FaqIGGGAC(10/14)BsmFIR0572GGGAC(10/14)BslFI, BsmFI, FinI^
FatI/CATGFatIR0650/CATGCviAII^, FaeI^, Hin1II^, Hsp92II ^, NlaIII^
CviAII^R0640C/ATG
NlaIII^R0125CATG/
FauICCCGC(4/6)FauIR0651CCCGC(4/6)SmuI
FauNDICA/TATGNdeIR0111CA/TATGNdeI
FbaIT/GATCABclIR0160T/GATCABclI, BsiQI, Ksp22I
FblIGT/MKACAccIR0161GT/MKACAccI, XmiI
FinIxGGGACBsmFI^R0572GGGAC(10/14)BslFI^, BsmFI^, FaqI^
FmuIxGGNC/CSau96I^R0165G/GNCCAspS9I ^, AsuI ^, BmgT120I^, BsiZI^, Cfr13I^, PspPI ^, Sau96I^, UnbI^
Fnu4HIGC/NGCFnu4HIR0178GC/NGCBisI , BlsI ^, BthCI^, Fsp4HI, GluI, ItaI , SatI
FnuDIIxCG/CGBstUI^R0518CG/CGAccII ^, Bsh1236I^, BspFNI, BstFNI^, BstUI^, MvnI^, ThaI^
FokIGGATG(9/13)FokIR0109GGATG(9/13)BseGI^, BstF5I^, BtsCI^
BtsCI^R0647GGATG(2/0)
FriOIGRGCY/CBanIIR0119GRGCY/CBanII, Eco24I, EcoT38I, HgiJII
FseIGGCCGG/CCFseIR0588GGCCGG/CCRigI
Fsp4HIGC/NGCFnu4HIR0178GC/NGCBisI , BlsI ^, BthCI^, Fnu4HI, GluI, ItaI , SatI
FspAIRTGC/GCAY
FspBIC/TAGBfaIR0568C/TAGBfaI, MaeI, XspI
FspEICC(12/16)FspEIR0662CC(12/16)
FspITGC/GCAFspIR0135TGC/GCAAcc16I , AviII , MstI, NsbI
FunIAGC/GCTAfeIR0652AGC/GCTAfeI, Aor51HI , Eco47III
FunIIG/AATTCEcoRI §R0101G/AATTCEcoRI
GauT27IxCGCGCAGG
Gba708IIATGCAC
GdiIIxCGGCCR(-5/-1)
GlaIGC/GCHhaI^R0139GCG/CAspLEI ^, BstHHI^, CfoI^, HhaI^, R9529^, HinP1I^, HspAI ^
HinP1I^R0124G/CGC
GluIGC/NGCFnu4HIR0178GC/NGCBisI , BlsI ^, BthCI^, Fnu4HI, Fsp4HI, ItaI , SatI
GsaICCCAGC(-1/-5)BseYI^R0635CCCAGC(-5/-1)BseYI^
GsuICTGGAG(16/14)BpmIR0565CTGGAG(16/14)BpmI
HaeIxWGG/CCW
HaeIIRGCGC/YHaeIIR0107RGCGC/YBfoI, Bsp143II, BstH2I
HaeIIIGG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BsnI, BspANI, BsuRI, PalI , PhoI
PhoIR0705GG/CC
HaeIVx(7/13)GAYNNNNNRTC(14/9)
HapIIC/CGGHpaIIR0171C/CGGBsiSI, HpaII, MspI
MspIR0106C/CGG
HbaIIGCCCAG
HgaIGACGC(5/10)HgaIR0154GACGC(5/10)CseI
HgiAIxGWGCW/CBsiHKAIR0570GWGCW/CAlw21I , AspHI , Bbv12I , BsiHKAI
HgiCIxG/GYRCCBanIR0118G/GYRCCAccB1I , BanI, BshNI, BspT107I
HgiEIIxACCNNNNNNGGT
HgiJIIxGRGCY/CBanIIR0119GRGCY/CBanII, Eco24I, EcoT38I, FriOI
HhaIGCG/CHhaIR0139GCG/CAspLEI , BstHHI, CfoI, GlaI^, R9529^, HinP1I^, HspAI ^
HinP1I^R0124G/CGC
Hin1IGR/CGYCBsaHIR0556GR/CGYCAcyI , BsaHI, BssNI, BstACI, Hsp92I
Hin1IICATG/CviAII^R0640C/ATGCviAII^, FaeI, FatI^, Hsp92II , NlaIII
FatI^R0650/CATG
NlaIIIR0125CATG/
Hin4Ix(8/13)GAYNNNNNVTC(13/8)
Hin4IIxCCTTC(6/5)HpyAVR0621CCTTC(6/5)HpyAV
R9529G/CGCHhaI^R0139GCG/CAspLEI ^, BstHHI^, CfoI^, GlaI^, HhaI^, HinP1I, HspAI
HinP1IR0124G/CGC
Hin6IG/CGCHhaI^R0139GCG/CAspLEI ^, BstHHI^, CfoI^, GlaI^, HhaI^, R9529, HinP1I, HspAI
HinP1IR0124G/CGC
HincIIGTY/RACHincIIR0103GTY/RAC
HindIIGTY/RAC
HindIIIA/AGCTTHindIII §R0104A/AGCTT
HinfIG/ANTCHinfIR0155G/ANTC
HinP1IG/CGCHinP1IR0124G/CGCAspLEI ^, BstHHI^, CfoI^, GlaI^, HhaI^, R9529, HspAI
HhaI^R0139GCG/C
HpaIGTT/AACHpaIR0105GTT/AACBstHPI, KspAI
HpaIIC/CGGHpaIIR0171C/CGGBsiSI, HapII, MspI
MspIR0106C/CGG
HphIGGTGA(8/7)HphIR0158GGTGA(8/7)AsuHPI
Hpy166IIGTN/NACHpy166IIR0616GTN/NACHpy8I^, MjaIV^
Hpy178IIIxTC/NNGAHpy188IIIR0622TC/NNGAHpy188III
Hpy188ITCN/GAHpy188IR0617TCN/GA
Hpy188IIITC/NNGAHpy188IIIR0622TC/NNGAHpy178III
Hpy8IGTN/NACHpy166II^R0616GTN/NACHpy166II^, MjaIV^
Hpy99ICGWCG/Hpy99IR0615CGWCG/
Hpy99XIIIxGCCTA
HpyAVCCTTC(6/5)HpyAVR0621CCTTC(6/5)Hin4II
HpyCH4IIIACN/GTHpyCH4IIIR0618ACN/GTBst4CI, TaaI, Tsp4CI
HpyCH4IVA/CGTHpyCH4IVR0619A/CGTHpySE526I, MaeII, TaiI^, TscI^
HpyCH4VTG/CAHpyCH4VR0620TG/CACviRI
HpyF10VIGCNNNNN/NNGCMwoIR0573GCNNNNN/NNGCBstMWI, MwoI
HpyF3IC/TNAGDdeIR0175C/TNAGBstDEI, DdeI
HpySE526IA/CGTHpyCH4IVR0619A/CGTHpyCH4IV, MaeII, TaiI^, TscI^
Hsp92IGR/CGYCBsaHIR0556GR/CGYCAcyI , BsaHI, BssNI, BstACI, Hin1I
Hsp92II CATG/CviAII^R0640C/ATGCviAII^, FaeI, FatI^, Hin1II, NlaIII
FatI^R0650/CATG
NlaIIIR0125CATG/
HspAI G/CGCHhaI^R0139GCG/CAspLEI ^, BstHHI^, CfoI^, GlaI^, HhaI^, R9529, HinP1I
HinP1IR0124G/CGC
I-CeuITAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)I-CeuIR0699TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceITAGGGATAACAGGGTAAT(-9/-13)I-SceIR0694TAGGGATAACAGGGTAAT(-9/-13)
ItaI GC/NGCFnu4HIR0178GC/NGCBisI , BlsI ^, BthCI^, Fnu4HI, Fsp4HI, GluI, SatI
KasIG/GCGCCKasIR0544G/GCGCCBbeI ^, DinI^, EgeI^, Mly113I^, NarI^, PluTI^, SfoI^, SspDI
NarI^R0191GG/CGCC
PluTI^R0713GGCGC/C
SfoI^R0606GGC/GCC
KflIGG/GWCCC
Kpn2I T/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, BsiMI, Bsp13I, BspEI, BspMII, MroI
KpnIGGTAC/CKpnI §R0142GGTAC/CAcc65I^, Asp718I ^
Acc65I^R0599G/GTACC
KroIG/CCGGCNaeI^R0190GCC/GGCMroNI, NaeI^, NgoAIV, NgoMIV, PdiI ^
NgoMIVR0564G/CCGGC
Ksp22I T/GATCABclIR0160T/GATCABclI, BsiQI, FbaI
Ksp632IxCTCTTC(1/4)EarIR0528CTCTTC(1/4)Bst6I, Eam1104I, EarI
Ksp632IxCTCTTC(1/4)EarIR0528CTCTTC(1/4)Bst6I, Eam1104I, EarI, Ksp632I
KspAIGTT/AACHpaIR0105GTT/AACBstHPI, HpaI
KspICCGC/GGSacIIR0157CCGC/GGCfr42I, SacII, Sfr303I, SgrBI, SstII
Kzo9I/GATCBfuCIR0636/GATCBfuCI, BscFI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, MalI^, MboI, NdeII^, Sau3AI
DpnI^R0176GA/TC
MboIR0147/GATC
Sau3AIR0169/GATC
LguIGCTCTTC(1/4)BspQIR0712GCTCTTC(1/4)BspQI, Nt.BspQI^, PciSI , SapI
Nt.BspQI^R0644GCTCTTC(1/-7)
SapIR0569GCTCTTC(1/4)
LlaGIxCTNGAYG
Lmo911IITAGRAG
LpnPICCDG(10/14)LpnPIR0663CCDG(10/14)
Lsp1109IGCAGC(8/12)BbvIR0173GCAGC(8/12)BbvI, BseXI, Bst71I, BstV1I
LweIGCATC(5/9)SfaNIR0172GCATC(5/9)BmsI, SfaNI
MabIA/CCWGGTSexAIR0605A/CCWGGTCsiI, SexAI
MaeIC/TAGBfaIR0568C/TAGBfaI, FspBI, XspI
MaeIIA/CGTHpyCH4IVR0619A/CGTHpyCH4IV, HpySE526I, TaiI^, TscI^
MaeIII/GTNAC
MalIGA/TCBfuCI^R0636/GATCBfuCI^, BscFI^, Bsp143I^, BssMI^, BstENII^, BstKTI^, BstMBI^, DpnI^, Kzo9I^, MboI^, NdeII^, Sau3AI^
DpnI^R0176GA/TC
MboI^R0147/GATC
Sau3AI^R0169/GATC
MamIGATNN/NNATCBsaBIR0537GATNN/NNATCBsaBI, Bse8I, BseJI, BsiBI, BsrBRI
MaqIxCRTTGAC(21/19)
MauBICG/CGCGCG
MbiICCGCTC(-3/-3)BsrBIR0102CCGCTC(-3/-3)AccBSI , BsrBI
MboI/GATCMboIR0147/GATCBfuCI, BscFI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, NdeII^, Sau3AI
BfuCIR0636/GATC
DpnI^R0176GA/TC
Sau3AIR0169/GATC
MboIIGAAGA(8/7)MboIIR0148GAAGA(8/7)
McrIxCGRY/CGBsiEIR0554CGRY/CGBsaOI, Bsh1285I , BsiEI, BstMCI
MfeIC/AATTGMfeI §R0589C/AATTGMunI
MflIR/GATCYBstYIR0523R/GATCYBstX2I, BstYI, PsuI, XhoII
MhlIGDGCH/CBsp1286IR0120GDGCH/CBmyI, Bsp1286I, SduI
MjaIVxGTNNACHpy166II^R0616GTN/NACHpy166II^, Hpy8I^
MkaDIIGAGAYGT
MlsITGG/CCAMscIR0534TGG/CCABalI , MluNI, MscI, Msp20I
MluCI/AATTMluCIR0538/AATTSse9I, TasI, Tsp509I, TspEI
Tsp509IR0576/AATT
MluIA/CGCGTMluI §R0198A/CGCGT
MluNITGG/CCAMscIR0534TGG/CCABalI , MlsI, MscI, Msp20I
Mly113IGG/CGCCKasI^R0544G/GCGCCBbeI ^, DinI^, EgeI^, KasI^, NarI, PluTI^, SfoI^, SspDI^
NarIR0191GG/CGCC
PluTI^R0713GGCGC/C
SfoI^R0606GGC/GCC
MlyIGAGTC(5/5)MlyIR0610GAGTC(5/5)Nt.BstNBI^, PleI^, PpsI ^, SchI
Nt.BstNBI^R0607GAGTC(4/-5)
PleI^R0515GAGTC(4/5)
MmeITCCRAC(20/18)MmeIR0637TCCRAC(20/18)
MnlICCTC(7/6)MnlIR0163CCTC(7/6)
Mph1103IATGCA/TNsiI §R0127ATGCA/TAvaIII ^, BfrBl, EcoT22I, NsiI, Zsp2I
MreICG/CCGGCG
MroIT/CCGGABspEIR0540T/CCGGAAccIII, Aor13HI , BlfI , BseAI, BsiMI, Bsp13I, BspEI, BspMII, Kpn2I
MroNIG/CCGGCNaeI^R0190GCC/GGCKroI, NaeI^, NgoAIV, NgoMIV, PdiI ^
NgoMIVR0564G/CCGGC
MroXIGAANN/NNTTCXmnIR0194GAANN/NNTTCAsp700I , PdmI , XmnI
MscITGG/CCAMscIR0534TGG/CCABalI , MlsI, MluNI, Msp20I
MseIT/TAAMseIR0525T/TAASaqAI, Tru1I
MslICAYNN/NNRTGMslIR0571CAYNN/NNRTGRseI^, SmiMI
Msp20ITGG/CCAMscIR0534TGG/CCABalI , MlsI, MluNI, MscI
MspA1ICMG/CKGMspA1IR0577CMG/CKGNspBII
MspCIC/TTAAGAflIIR0520C/TTAAGAflII, BfrI , BspTI, Bst98I, BstAFI, Vha464I
MspIC/CGGMspIR0106C/CGGBsiSI, HapII, HpaII
HpaIIR0171C/CGG
MspJICNNR(9/13)MspJIR0661CNNR(9/13)
MspR9ICC/NGGBssKI^R0592/CCNGGBme1390I, BmrFI, BssKI^, BstSCI^, ScrFI, StyD4I^
ScrFIR0110CC/NGG
StyD4I^R0638/CCNGG
MssIGTTT/AAACPmeIR0560GTTT/AAACPmeI
MstIxTGC/GCAFspIR0135TGC/GCAAcc16I , AviII , FspI, NsbI
MtuHN878IICACGCAG
MunIC/AATTGMfeI §R0589C/AATTGMfeI
Mva1269IGAATGC(1/-1)BsmIR0134GAATGC(1/-1)BsaMI, BscCI, BsmI, Nb.BsmI^, PctI
Nb.BsmI^R0706GAATGC
MvaICC/WGGBstNIR0168CC/WGGAjnI ^, BciT130I, BptI, BseBI, BsiLI, Bst2UI, BstNI, BstOI, EcoRII^, Psp6I ^, PspGI^
PspGI^R0611/CCWGG
MvnICG/CGBstUIR0518CG/CGAccII , Bsh1236I, BspFNI^, BstFNI, BstUI, FnuDII^, ThaI
MvrIxCGAT/CGPvuI §R0150CGAT/CGBpvUI, BspCI, Ple19I , PvuI
MwoIGCNNNNN/NNGCMwoIR0573GCNNNNN/NNGCBstMWI, HpyF10VI
NaeIGCC/GGCNaeIR0190GCC/GGCKroI^, MroNI^, NgoAIV^, NgoMIV^, PdiI
NgoMIV^R0564G/CCGGC
NarIGG/CGCCNarIR0191GG/CGCCBbeI ^, DinI^, EgeI^, KasI^, Mly113I, PluTI^, SfoI^, SspDI^
KasI^R0544G/GCGCC
PluTI^R0713GGCGC/C
SfoI^R0606GGC/GCC
Nb.BbvCICCTCAGCNb.BbvCIR0631CCTCAGCBbvCI^, Nt.BbvCI^
BbvCI^R0601CCTCAGC(-5/-2)
Nt.BbvCI^R0632CCTCAGC(-5/-7)
Nb.BsmIGAATGCNb.BsmIR0706GAATGCBsaMI^, BscCI^, BsmI^, Mva1269I^, PctI ^
BsmI^R0134GAATGC(1/-1)
Nb.BsrDIGCAATGNb.BsrDIR0648GCAATGBse3DI^, BseMI^, BsrDI^
BsrDI^R0574GCAATG(2/0)
Nb.BssSICACGAGNb.BssSIR0681CACGAGBauI ^, BsiI^, BssSαI^, Bst2BI^
BssSαI^R0680CACGAG(-5/-1)
Nb.BtsIGCAGTGNb.BtsIR0707GCAGTGBtsαI^, BtsI^
BtsαI^R0667GCAGTG(2/0)
BtsI^R0614GCAGTG(2/0)
NciICC/SGGNciIR0196CC/SGGAsuC2I , BcnI , BpuMI, CauII, EcoHI^
NcoIC/CATGGNcoI §R0193C/CATGGBsp19I
NdeICA/TATGNdeIR0111CA/TATGFauNDI
NdeII/GATCBfuCI^R0636/GATCBfuCI^, BscFI^, Bsp143I^, BssMI^, BstENII^, BstKTI^, BstMBI^, DpnI^, Kzo9I^, MalI^, MboI^, Sau3AI^
DpnI^R0176GA/TC
MboI^R0147/GATC
Sau3AI^R0169/GATC
NgoAIVG/CCGGCNaeI^R0190GCC/GGCKroI, MroNI, NaeI^, NgoMIV, PdiI ^
NgoMIVR0564G/CCGGC
NgoAVIIIx(12/14)GACNNNNNTGA(13/11)
NgoMIVG/CCGGCNgoMIVR0564G/CCGGCKroI, MroNI, NaeI^, NgoAIV, PdiI ^
NaeI^R0190GCC/GGC
NhaXIxCAAGRAG
NheIG/CTAGCNheI §R0131G/CTAGCAsuNHI , BmtI^, BspOI^
BmtI^ §R0658GCTAG/C
NlaCIxCATCAC(19/17)
NlaIIICATG/NlaIIIR0125CATG/CviAII^, FaeI, FatI^, Hin1II, Hsp92II
CviAII^R0640C/ATG
FatI^R0650/CATG
NlaIVGGN/NCCNlaIVR0126GGN/NCCBmiI, BscBI, BspLI, PspN4I
NmeAIIIGCCGAG(21/19)NmeAIIIR0711GCCGAG(21/19)
NmuCI/GTSACTsp45IR0583/GTSACTseFI^, Tsp45I
NotIGC/GGCCGCNotI §R0189GC/GGCCGCCciNI
NruGI GACNNN/NNGTCAhdIR0584GACNNN/NNGTCAhdI, AspEI , BmeRI, DriI, Eam1105I, EclHKI
NruITCG/CGANruI §R0192TCG/CGABsp68I, BtuMI, RruI^
NsbI TGC/GCAFspIR0135TGC/GCAAcc16I , AviII , FspI, MstI
NsiIATGCA/TNsiI §R0127ATGCA/TAvaIII ^, BfrBl, EcoT22I, Mph1103I, Zsp2I
NspBII xCMG/CKGMspA1IR0577CMG/CKGMspA1I
NspIRCATG/YNspIR0602RCATG/YBstNSI, XceI
NspIII C/YCGRGAvaIR0152C/YCGRGAma87I , AvaI, BcoI , BmeT110I, BsiHKCI, BsoBI, Eco88I
BsoBIR0586C/YCGRG
NspV TT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, Bsp119I, BspT104I, BstBI, Csp45I, SfuI
Nt.AlwIGGATC(4/-5)Nt.AlwIR0627GGATC(4/-5)AclWI ^, AlwI^, BinI^, BspPI^
AlwI^R0513GGATC(4/5)
Nt.BbvCICCTCAGC(-5/-7)Nt.BbvCIR0632CCTCAGC(-5/-7)BbvCI^, Nb.BbvCI^
BbvCI^R0601CCTCAGC(-5/-2)
Nb.BbvCI^R0631CCTCAGC
Nt.BsmAIGTCTC(1/-5)Nt.BsmAIR0121GTCTC(1/-5)Alw26I ^, BcoDI^, BsmAI^, BsoMAI^, BstMAI^
BcoDI^R0542GTCTC(1/5)
BsmAI^R0529GTCTC(1/5)
Nt.BspQIGCTCTTC(1/-7)Nt.BspQIR0644GCTCTTC(1/-7)BspQI^, LguI^, PciSI ^, SapI^
BspQI^R0712GCTCTTC(1/4)
SapI^R0569GCTCTTC(1/4)
Nt.BstNBIGAGTC(4/-5)Nt.BstNBIR0607GAGTC(4/-5)MlyI^, PleI^, PpsI ^, SchI^
MlyI^R0610GAGTC(5/5)
PleI^R0515GAGTC(4/5)
Nt.CviPII(0/-1)CCDNt.CviPIIR0626(0/-1)CCD
OliI CACNN/NNGTGAleIR0634CACNN/NNGTGAleI
PacITTAAT/TAAPacIR0547TTAAT/TAA
PaeI GCATG/CSphI §R0182GCATG/CBbuI , SpaHI, SphI
PaeR7IC/TCGAGPaeR7IR0177C/TCGAGBssHI, Sfr274I, SlaI, StrI, TliI, XhoI
TliIR0612C/TCGAG
XhoIR0146C/TCGAG
PagI T/CATGABspHIR0517T/CATGABspHI, CciI, RcaI
PalAI GG/CGCGCCAscIR0558GG/CGCGCCAscI, SgsI
PalI GG/CCHaeIIIR0108GG/CCAoxI^, BshFI , BsnI, BspANI, BsuRI, HaeIII, PhoI
PhoIR0705GG/CC
PasI CC/CWGGG
PauI G/CGCGCBssHIIR0199G/CGCGCBsePI, BssHII, PteI
PceI AGG/CCTStuIR0187AGG/CCTAatI , Eco147I, SseBI, StuI
PciIA/CATGTPciIR0655A/CATGTBspLU11I, PscI
PciSI GCTCTTC(1/4)BspQIR0712GCTCTTC(1/4)BspQI, LguI, Nt.BspQI^, SapI
Nt.BspQI^R0644GCTCTTC(1/-7)
SapIR0569GCTCTTC(1/4)
PcsIWCGNNNN/NNNCGW
PctI GAATGC(1/-1)BsmIR0134GAATGC(1/-1)BsaMI, BscCI, BsmI, Mva1269I, Nb.BsmI^
Nb.BsmI^R0706GAATGC
PdiI GCC/GGCNaeIR0190GCC/GGCKroI^, MroNI^, NaeI, NgoAIV^, NgoMIV^
NgoMIV^R0564G/CCGGC
PdmI GAANN/NNTTCXmnIR0194GAANN/NNTTCAsp700I , MroXI, XmnI
PenIxGCAGT
PfeI G/AWTCTfiIR0546G/AWTCTfiI
Pfl1108I xTCGTAG
Pfl23II C/GTACGBsiWIR0553C/GTACGBsiWI, PspLI , SplI, SunI
PflBI CCANNNN/NTGGPflMIR0509CCANNNN/NTGGAccB7I , BasI , PflMI, Van91I
PflFIGACN/NNGTCPflFIR0595GACN/NNGTCAspI , PsyI, TelI, Tth111I
Tth111IR0185GACN/NNGTC
PflMICCANNNN/NTGGPflMIR0509CCANNNN/NTGGAccB7I , BasI , PflBI , Van91I
PfoI T/CCNGGA
PhoIGG/CCPhoIR0705GG/CCAoxI^, BshFI , BsnI, BspANI, BsuRI, HaeIII, PalI
HaeIIIR0108GG/CC
PinAI A/CCGGTAgeI §R0552A/CCGGTAgeI, AsiAI , BshTI, CspAI
PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)PI-PspIR0695TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)PI-SceIR0696ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
PlaDIxCATCAG(21/19)
Ple19I CGAT/CGPvuI §R0150CGAT/CGBpvUI, BspCI, MvrI, PvuI
PleIGAGTC(4/5)PleIR0515GAGTC(4/5)MlyI^, Nt.BstNBI^, PpsI , SchI^
MlyI^R0610GAGTC(5/5)
Nt.BstNBI^R0607GAGTC(4/-5)
PluTIGGCGC/CPluTIR0713GGCGC/CBbeI , DinI^, EgeI^, KasI^, Mly113I^, NarI^, SfoI^, SspDI^
KasI^R0544G/GCGCC
NarI^R0191GG/CGCC
SfoI^R0606GGC/GCC
PmaCI CAC/GTGPmlIR0532CAC/GTGAcvI , BbrPI , Eco72I, PmlI, PspCI
PmeIGTTT/AAACPmeIR0560GTTT/AAACMssI
PmlICAC/GTGPmlIR0532CAC/GTGAcvI , BbrPI , Eco72I, PmaCI , PspCI
PpiI x(7/12)GAACNNNNNCTC(13/8)
PpsI GAGTC(4/5)MlyI^R0610GAGTC(5/5)MlyI^, Nt.BstNBI^, PleI, SchI^
Nt.BstNBI^R0607GAGTC(4/-5)
PleIR0515GAGTC(4/5)
Ppu21I YAC/GTRBsaAIR0531YAC/GTRBsaAI, BstBAI
PpuMIRG/GWCCYPpuMIR0506RG/GWCCYPsp5II
PpuXI RG/GWCCYPpuMIR0506RG/GWCCYPpuMI, Psp5II
PscI A/CATGTPciIR0655A/CATGTBspLU11I, PciI
PshAIGACNN/NNGTCPshAIR0593GACNN/NNGTCBoxI, BstPAI
PshBI AT/TAATAseIR0526AT/TAATAseI, AsnI , VspI
PsiITTA/TAAPsiIR0657TTA/TAAAanI
Psp124BI GAGCT/CEco53kI^R0116GAG/CTCEcl136II^, Eco53kI^, EcoICRI^, SacI, SstI
SacI §R0156GAGCT/C
Psp1406I AA/CGTTAclIR0598AA/CGTTAclI
Psp5II RG/GWCCYPpuMIR0506RG/GWCCYPpuMI
Psp6I /CCWGGBstNI^R0168CC/WGGAjnI ^, BciT130I^, BptI^, BseBI^, BsiLI^, Bst2UI^, BstNI^, BstOI^, EcoRII, MvaI^, PspGI
PspGIR0611/CCWGG
PspAI C/CCGGGSmaI^R0141CCC/GGGCfr9I, SmaI^, TspMI, XmaCI
TspMIR0709C/CCGGG
PspCI CAC/GTGPmlIR0532CAC/GTGAcvI , BbrPI , Eco72I, PmaCI , PmlI
PspEI G/GTNACCBstEII  §R0162G/GTNACCBstEII , BstPI, Eco065I, Eco91I, EcoO65I
PspGI/CCWGGPspGIR0611/CCWGGAjnI ^, BciT130I^, BptI^, BseBI^, BsiLI^, Bst2UI^, BstNI^, BstOI^, EcoRII, MvaI^, Psp6I
BstNI^R0168CC/WGG
PspLI C/GTACGBsiWIR0553C/GTACGBsiWI, Pfl23II , SplI, SunI
PspN4I GGN/NCCNlaIVR0126GGN/NCCBmiI, BscBI, BspLI, NlaIV
PspO3IxGGWC/CAvaII^R0153G/GWCCAflI ^, AvaII^, Bme18I^, Eco47I^, SinI^, Vpak11AI^
PspOMIG/GGCCCPspOMIR0653G/GGCCCApaI^, Bsp120I
ApaI^R0114GGGCC/C
PspOMIIxCGCCCAR(20/18)
PspPI G/GNCCSau96IR0165G/GNCCAspS9I , AsuI , BmgT120I^, BsiZI, Cfr13I, FmuI^, Sau96I, UnbI^
PspPRIxCCYCAG(15/13)
PspXIVC/TCGAGBPspXIR0656VC/TCGAGB
PsrI(7/12)GAACNNNNNNTAC(12/7)
PssIxRGGNC/CYEcoO109I^R0503RG/GNCCYDraII^, EcoO109I^
PstICTGCA/GPstI §R0140CTGCA/GBspMAI
PstNICAGNNN/CTGAlwNIR0514CAGNNN/CTGAlwNI, CaiI
PsuIR/GATCYBstYIR0523R/GATCYBstX2I, BstYI, MflI, XhoII
PsyIGACN/NNGTCPflFIR0595GACN/NNGTCAspI , PflFI, TelI, Tth111I
Tth111IR0185GACN/NNGTC
PteIG/CGCGCBssHIIR0199G/CGCGCBsePI, BssHII, PauI
PvuICGAT/CGPvuI §R0150CGAT/CGBpvUI, BspCI, MvrI, Ple19I
PvuIICAG/CTGPvuII §R0151CAG/CTG
RcaIT/CATGABspHIR0517T/CATGABspHI, CciI, PagI
RceIxCATCGAC(20/18)
RdeGBIxCCGCAG
RdeGBIIxACCCAG(20/18)
RdeGBIIIx(9/11)TGRYCA(11/9)
RflFIIIxCGCCAG
RgaIGCGAT/CGCAsiSIR0630GCGAT/CGCAsiSI, SfaAI, SgfI
RigIGGCCGG/CCFseIR0588GGCCGG/CCFseI
RlaIxVCW
RleAIxCCCACA(12/9)
RpaB5IxCGRGGAC(20/18)
RpaBIxCCCGCAG(20/18)
RpaIxGTYGGAG(11/9)
RpaTIxGRTGGAG
RruITCG/CGANruI^ §R0192TCG/CGABsp68I^, BtuMI^, NruI^
RsaIGT/ACRsaIR0167GT/ACAfaI , Csp6I^, CviQI^
CviQI^R0639G/TAC
RsaNIG/TACCviQIR0639G/TACAfaI ^, Csp6I, CviQI, RsaI^
RsaI^R0167GT/AC
RseICAYNN/NNRTGMslI^R0571CAYNN/NNRTGMslI^, SmiMI^
Rsr2ICG/GWCCG
RsrIICG/GWCCGRsrIIR0501CG/GWCCGCpoI, CspI, Rsr2I
SacIGAGCT/CSacI §R0156GAGCT/CEcl136II^, Eco53kI^, EcoICRI^, Psp124BI , SstI
Eco53kI^R0116GAG/CTC
SacIICCGC/GGSacIIR0157CCGC/GGCfr42I, KspI, Sfr303I, SgrBI, SstII
SalIG/TCGACSalI §R0138G/TCGAC
SanDIxGG/GWCCC
SapIGCTCTTC(1/4)SapIR0569GCTCTTC(1/4)BspQI, LguI, Nt.BspQI^, PciSI
BspQIR0712GCTCTTC(1/4)
Nt.BspQI^R0644GCTCTTC(1/-7)
SaqAIT/TAAMseIR0525T/TAAMseI, Tru1I
SatIGC/NGCFnu4HIR0178GC/NGCBisI , BlsI ^, BthCI^, Fnu4HI, Fsp4HI, GluI, ItaI
Sau3AI/GATCSau3AIR0169/GATCBfuCI, BscFI, Bsp143I, BssMI, BstENII, BstKTI^, BstMBI, DpnI^, Kzo9I, MalI^, MboI, NdeII^
BfuCIR0636/GATC
DpnI^R0176GA/TC
MboIR0147/GATC
Sau96IG/GNCCSau96IR0165G/GNCCAspS9I , AsuI , BmgT120I^, BsiZI, Cfr13I, FmuI^, PspPI , UnbI^
SauIxCC/TNAGGBsu36IR0524CC/TNAGGAocI , AxyI , Bse21I, Bsu36I, CvnI, Eco81I
SbfICCTGCA/GGSbfI §R0642CCTGCA/GGSdaI, Sse8387I
ScaIAGT/ACTScaI §R0122AGT/ACTAcc113I , AssI , BmcAI^, ZrmI
SchIGAGTC(5/5)MlyIR0610GAGTC(5/5)MlyI, Nt.BstNBI^, PleI^, PpsI ^
Nt.BstNBI^R0607GAGTC(4/-5)
PleI^R0515GAGTC(4/5)
ScrFICC/NGGScrFIR0110CC/NGGBme1390I, BmrFI, BssKI^, BstSCI^, MspR9I, StyD4I^
BssKI^R0592/CCNGG
StyD4I^R0638/CCNGG
SdaICCTGCA/GGSbfI §R0642CCTGCA/GGSbfI, Sse8387I
SdeAIxCAGRAG(21/19)
SdeOSIx(11/-1)GACNNNNRTGA(12/-11)
SduIGDGCH/CBsp1286IR0120GDGCH/CBmyI, Bsp1286I, MhlI
SecIxC/CNNGGBsaJIR0536C/CNNGGBsaJI, BseDI, BssECI
SetIASST/
SexAIA/CCWGGTSexAIR0605A/CCWGGTCsiI, MabI
SfaAIGCGAT/CGCAsiSIR0630GCGAT/CGCAsiSI, RgaI, SgfI
SfaNIGCATC(5/9)SfaNIR0172GCATC(5/9)BmsI, LweI
SfcIC/TRYAGSfcIR0561C/TRYAGBfmI , BpcI, BstSFI
SfeIxC/TRYAGSfcIR0561C/TRYAGBfmI , BpcI, BstSFI, SfcI
SfiIGGCCNNNN/NGGCCSfiIR0123GGCCNNNN/NGGCC
SfoIGGC/GCCSfoIR0606GGC/GCCBbeI ^, DinI, EgeI, KasI^, Mly113I^, NarI^, PluTI^, SspDI^
KasI^R0544G/GCGCC
NarI^R0191GG/CGCC
PluTI^R0713GGCGC/C
Sfr274IC/TCGAGPaeR7IR0177C/TCGAGBssHI, PaeR7I, SlaI, StrI, TliI, XhoI
TliIR0612C/TCGAG
XhoIR0146C/TCGAG
Sfr303ICCGC/GGSacIIR0157CCGC/GGCfr42I, KspI, SacII, SgrBI, SstII
SfuITT/CGAABstBIR0519TT/CGAAAsuII , Bpu14I, BsiCI, Bsp119I, BspT104I, BstBI, Csp45I, NspV
SgeICNNGNNNNNNNNN/NNNN
SgfIGCGAT/CGCAsiSIR0630GCGAT/CGCAsiSI, RgaI, SfaAI
SgrAICR/CCGGYGSgrAIR0603CR/CCGGYG
SgrBICCGC/GGSacIIR0157CCGC/GGCfr42I, KspI, SacII, Sfr303I, SstII
SgrDICG/TCGACG
SgrTIxCCDS(10/14)
SgsIGG/CGCGCCAscIR0558GG/CGCGCCAscI, PalAI
SimIxGGGTC(-3/0)
SinIG/GWCCAvaIIR0153G/GWCCAflI , AvaII, Bme18I, Eco47I, PspO3I^, Vpak11AI^
SlaIC/TCGAGPaeR7IR0177C/TCGAGBssHI, PaeR7I, Sfr274I, StrI, TliI, XhoI
TliIR0612C/TCGAG
XhoIR0146C/TCGAG
SmaICCC/GGGSmaIR0141CCC/GGGCfr9I^, PspAI ^, TspMI^, XmaCI^
TspMI^R0709C/CCGGG
SmiIATTT/AAATSwaIR0604ATTT/AAATSwaI
SmiMICAYNN/NNRTGMslIR0571CAYNN/NNRTGMslI, RseI^
SmlIC/TYRAGSmlIR0597C/TYRAG
SmoIC/TYRAG
SmuICCCGC(4/6)FauIR0651CCCGC(4/6)FauI
SnaBITAC/GTASnaBIR0130TAC/GTABstSNI, Eco105I
SnaIxGTATACBstZ17I^R0594GTA/TACBssNAI^, Bst1107I^, BstZ17I^
Sno506IxGGCCGAG
SpaHIGCATG/CSphI §R0182GCATG/CBbuI , PaeI , SphI
SpeIA/CTAGTSpeI §R0133A/CTAGTAhlI , BcuI
SphIGCATG/CSphI §R0182GCATG/CBbuI , PaeI , SpaHI
SplIxC/GTACGBsiWIR0553C/GTACGBsiWI, Pfl23II , PspLI , SunI
SpoDIxGCGGRAG
SrfIGCCC/GGGCSrfIR0629GCCC/GGGC
Sse232IxCG/CCGGCG
Sse8387ICCTGCA/GGSbfI §R0642CCTGCA/GGSbfI, SdaI
Sse8647IxAG/GWCCT
Sse9I/AATTMluCIR0538/AATTMluCI, TasI, Tsp509I, TspEI
Tsp509IR0576/AATT
SseBIAGG/CCTStuIR0187AGG/CCTAatI , Eco147I, PceI , StuI
SsiICCGC(-3/-1)AciIR0551CCGC(-3/-1)AciI, BspACI
SspBIxT/GTACABsrGI §R0575T/GTACAAauI , Bsp1407I, BsrGI, BstAUI
SspDIG/GCGCCKasIR0544G/GCGCCBbeI ^, DinI^, EgeI^, KasI, Mly113I^, NarI^, PluTI^, SfoI^
NarI^R0191GG/CGCC
PluTI^R0713GGCGC/C
SfoI^R0606GGC/GCC
SspIAAT/ATTSspI §R0132AAT/ATT
SstE37IxCGAAGAC(20/18)
SstIGAGCT/CEco53kI^R0116GAG/CTCEcl136II^, Eco53kI^, EcoICRI^, Psp124BI , SacI
SacI §R0156GAGCT/C
SstIICCGC/GGSacIIR0157CCGC/GGCfr42I, KspI, SacII, Sfr303I, SgrBI
Sth132IxCCCG(4/8)
Sth20745IIIGGACGAC
StrIxC/TCGAGPaeR7IR0177C/TCGAGBssHI, PaeR7I, Sfr274I, SlaI, TliI, XhoI
TliIR0612C/TCGAG
XhoIR0146C/TCGAG
StuIAGG/CCTStuIR0187AGG/CCTAatI , Eco147I, PceI , SseBI
StyD4I/CCNGGStyD4IR0638/CCNGGBme1390I^, BmrFI^, BssKI, BstSCI, MspR9I^, ScrFI^
BssKIR0592/CCNGG
ScrFI^R0110CC/NGG
StyIC/CWWGGStyI §R0500C/CWWGGBssT1I, Eco130I, EcoT14I, ErhI
SunIC/GTACGBsiWIR0553C/GTACGBsiWI, Pfl23II , PspLI , SplI
SwaIATTT/AAATSwaIR0604ATTT/AAATSmiI
TaaIACN/GTHpyCH4IIIR0618ACN/GTBst4CI, HpyCH4III, Tsp4CI
TaiIACGT/HpyCH4IV^R0619A/CGTHpyCH4IV^, HpySE526I^, MaeII^, TscI
TaqαIT/CGATaqαIR0149T/CGATthHB8I
TaqIT/CGATaqαIR0149T/CGATaqαI, TthHB8I
TaqIIGACCGA(11/9)
TasI/AATTMluCIR0538/AATTMluCI, Sse9I, Tsp509I, TspEI
Tsp509IR0576/AATT
TatIW/GTACW
TauIGCSG/C
TelIGACN/NNGTCPflFIR0595GACN/NNGTCAspI , PflFI, PsyI, Tth111I
Tth111IR0185GACN/NNGTC
TfiIG/AWTCTfiIR0546G/AWTCPfeI
ThaICG/CGBstUIR0518CG/CGAccII , Bsh1236I, BspFNI^, BstFNI, BstUI, FnuDII^, MvnI
TliIC/TCGAGTliIR0612C/TCGAGBssHI, PaeR7I, Sfr274I, SlaI, StrI, XhoI
PaeR7IR0177C/TCGAG
XhoIR0146C/TCGAG
Tru1IT/TAAMseIR0525T/TAAMseI, SaqAI
Tru9IT/TAAMseIR0525T/TAAMseI, SaqAI, Tru1I
TscAINNCASTGNN/TspRIR0582NNCASTGNN/TspRI
TscIACGT/HpyCH4IV^R0619A/CGTHpyCH4IV^, HpySE526I^, MaeII^, TaiI
TseFIGTSAC/Tsp45I^R0583/GTSACNmuCI^, Tsp45I^
TseIG/CWGCTseIR0591G/CWGCApeKI
ApeKIR0643G/CWGC
TsoIxTARCCA(11/9)
Tsp45I/GTSACTsp45IR0583/GTSACNmuCI, TseFI^
Tsp4CIxACN/GTHpyCH4IIIR0618ACN/GTBst4CI, HpyCH4III, TaaI
Tsp509I/AATTTsp509IR0576/AATTMluCI, Sse9I, TasI, TspEI
MluCIR0538/AATT
TspDTIATGAA(11/9)
TspEIx/AATTMluCIR0538/AATTMluCI, Sse9I, TasI, Tsp509I
Tsp509IR0576/AATT
TspEIx/AATTMluCIR0538/AATTMluCI, Sse9I, TasI, Tsp509I, TspEI
Tsp509IR0576/AATT
TspGWIACGGA(11/9)
TspMIC/CCGGGTspMIR0709C/CCGGGCfr9I, PspAI , SmaI^, XmaCI
SmaI^R0141CCC/GGG
TspRINNCASTGNN/TspRIR0582NNCASTGNN/TscAI
TssIxGAGNNNCTC
TstIx(8/13)CACNNNNNNTCC(12/7)
TsuIxGCGAC
Tth111IGACN/NNGTCTth111IR0185GACN/NNGTCAspI , PflFI, PsyI, TelI
PflFIR0595GACN/NNGTC
Tth111IIxCAARCA(11/9)
TthHB8IT/CGATaqαIR0149T/CGATaqαI
UbaF11IxTCGTA
UbaF12IxCTACNNNGTC
UbaF13IxGAGNNNNNNCTGG
UbaF14IxCCANNNNNTCG
UbaF9IxTACNNNNNRTGT
UbaPIxCGAACG
UnbIx/GGNCCSau96I^R0165G/GNCCAspS9I ^, AsuI ^, BmgT120I^, BsiZI^, Cfr13I^, FmuI^, PspPI ^, Sau96I^
Van91ICCANNNN/NTGGPflMIR0509CCANNNN/NTGGAccB7I , BasI , PflBI , PflMI
Vha464IC/TTAAGAflIIR0520C/TTAAGAflII, BfrI , BspTI, Bst98I, BstAFI, MspCI
VneIG/TGCACApaLIR0507G/TGCACAlw44I , ApaLI
Vpak11AIx/GGWCCAvaII^R0153G/GWCCAflI ^, AvaII^, Bme18I^, Eco47I^, PspO3I^, SinI^
VpaK11BIG/GWCCAvaIIR0153G/GWCCAflI , AvaII, Bme18I, Eco47I, PspO3I^, SinI, Vpak11AI^
VspIAT/TAATAseIR0526AT/TAATAseI, AsnI , PshBI
WviIxCACRAG(20/18)
XagICCTNN/NNNAGGEcoNIR0521CCTNN/NNNAGGBstENI, EcoNI
XapIR/AATTYApoI §R0566R/AATTYAcsI , ApoI
XbaIT/CTAGAXbaIR0145T/CTAGA
XceIRCATG/YNspIR0602RCATG/YBstNSI, NspI
XcmICCANNNNN/NNNNTGGXcmIR0533CCANNNNN/NNNNTGG
XhoIC/TCGAGXhoIR0146C/TCGAGBssHI, PaeR7I, Sfr274I, SlaI, StrI, TliI
PaeR7IR0177C/TCGAG
TliIR0612C/TCGAG
XhoIIR/GATCYBstYIR0523R/GATCYBstX2I, BstYI, MflI, PsuI
XmaCIC/CCGGGSmaI^R0141CCC/GGGCfr9I, PspAI , SmaI^, TspMI
TspMIR0709C/CCGGG
XmaIC/CCGGGXmaIR0180C/CCGGGCfr9I, PspAI , SmaI^, TspMI, XmaCI
TspMIR0709C/CCGGG
XmaIIIxC/GGCCGEagI §R0505C/GGCCGBseX3I , BstZI, EagI, EclXI, Eco52I
XmaJIC/CTAGGAvrIIR0174C/CTAGGAspA2I , AvrII, BlnI , BspA2I
XmiIGT/MKACAccIR0161GT/MKACAccI, FblI
XmnIGAANN/NNTTCXmnIR0194GAANN/NNTTCAsp700I , MroXI, PdmI
XspIC/TAGBfaIR0568C/TAGBfaI, FspBI, MaeI
ZhoIAT/CGATBspDIR0557AT/CGATBanIII , Bsa29I, BseCI, BshVI, BsiXI, Bsp106I, BspDI, BspXI, Bsu15I, BsuTUI, ClaI
ClaIR0197AT/CGAT
ZraIGAC/GTCZraIR0659GAC/GTCAatII^
AatII^R0117GACGT/C
ZrmIAGT/ACTScaI §R0122AGT/ACTAcc113I , AssI , BmcAI^, ScaI
Zsp2IATGCA/TNsiI §R0127ATGCA/TAvaIII ^, BfrBl, EcoT22I, Mph1103I, NsiI