New England Biolabs

Frequencies of Restriction Sites

  • My NEB
  • Print
  • PDF
  • The table below summarizes the frequencies with which restriction endonuclease sites occur in commonly used DNA molecules. Detailed restriction maps can be found on DNA sequences and maps. The sites listed in these tables were identified by computer analysis of published sequences. Although we have tried to ensure their accuracy, the sites have not necessarily been confirmed by experimentation. When the same specificity is displayed by several enzymes, the site is listed by the name of the enzyme that is available from New England Biolabs. Other enzymes with the same specificity are listed in the table of isoschizomers. Recognition sequences are written 5´ to 3´.

    EnzymeRecognition SequenceAdeno-2LambdaLITMUS28iM13mp18pBR322pGLuc-Basic2pGLuc-BasicpKLAC2pMAL-p5xpSNAPfpTXB1pTYB21pUC19T7
    AatIIGACGT/C310101110051011
    AbaSI
    Acc65IG/GTACC82110110020115
    AccIGT/MKAC1790123351253133
    AciICCGC(-3/-1)58251627426766648180751029234199
    AclIAA/CGTT3732422253129219
    AcuICTGAAG(16/14)2340202948452221
    AfeIAGC/GCT132014000201200
    AflIIC/TTAAG430000000000019
    AflIIIA/CRYGT25201315142534123
    AgeIA/CCGGT513100001011002
    AgeI-HFA/CCGGT5131000101002
    AhdIGACNNN/NNGTC992011212122114
    AleICACNN/NNGTG1020010001010208
    AluIAG/CT1581431527173125382827303416140
    AlwIGGATC(4/5)35581031221201812201516101
    AlwNICAGNNN/CTG25411112252412115
    ApaIGGGCC/C121000000111100
    ApaLIG/TGCAC74203233644431
    ApeKIG/CWGC179199910212223272520272912116
    ApoIR/AATTY2958311033195357113
    AscIGG/CGCGCC22000000010000
    AseIAT/TAAT31717144547104312
    AsiSIGCGAT/CGC10000000000000
    AvaIC/YCGRG408221232123114
    AvaIIG/GWCC73352184379668254
    AvrIIC/CTAGG22100110010003
    BaeGIGKGCM/C45102134588865316
    BaeI(10/15)ACNNNNGTAYC(12/7)510130101000103
    BamHIG/GATCC35111111111110
    BamHI-HF®G/GATCC351111111110
    BanIG/GYRCC572547976748812433
    BanIIGRGCY/C577222565253611
    BbsIGAAGAC(2/6)27240032133244038
    BbvCICCTCAGC(-5/-2)970200000000010
    BbvIGCAGC(8/12)179199910212223272520272912116
    BccICCATC(4/5)62145514925112216814253121
    BceAIACGGC(12/14)8011537375131181310247
    BcgI(10/12)CGANNNNNNTGC(12/10)10281031164146119
    BciVIGTATCC(6/5)9262024434344223
    BclIT/GATCA58000212211201
    BcoDIGTCTC(1/5)603735393118489495
    BfaIC/TAG541375512101931488460
    BfuAIACCTGC(4/8)39410315454423118
    BfuCI/GATC871161662238333523312429156
    BglIGCCNNNN/NGGC2029213113172322
    BglIIA/GATCT116110311120201
    BlpIGC/TNAGC860000001011020
    BmgBICACGTC(-3/-3)1517000101120008
    BmrIACTGGG(5/4)22421532511826
    BmtIGCTAG/C41001004011101
    BmtI-HF®GCTAG/C
    BpmICTGGAG(16/14)32251246434156123
    Bpu10ICCTNAGC(-5/-2)23190410001202039
    BpuEICTTGAG(16/14)19134466675979456
    BsaAIYAC/GTR22142514240324035
    BsaBIGATNN/NNATC221021422211307
    BsaHIGR/CGYC44402165565812738
    BsaIGGTCTC(1/5)1821011132222129
    BsaI-HF®GGTCTC(1/5)18210113222129
    BsaJIC/CNNGG23410569816211810171515585
    BsaWIW/CCGGW28814654487586332
    BsaXI(9/12)ACNNNNNCTCC(10/7)29191404331123112
    BseRIGAGGAG(10/8)63190102120300013
    BseYICCCAGC(-5/-1)31321325534544129
    BsgIGTGCAG(16/14)34410011346354021
    BsiEICGRY/CG502243767118698517
    BsiHKAIGWGCW/C38284386889977524
    BsiWIC/GTACG41100000101000
    BslICCNNNNN/NNGG2161768172021151816263125690
    BsmAIGTCTC(1/5)60373533118810495
    BsmBICGTCTC(1/5)21141112022022216
    BsmFIGGGAC(10/14)59380249741546046
    BsmIGAATGC(1/-1)10461114131510015
    BsoBIC/YCGRG408221232123114
    Bsp1286IGDGCH/C10538551012151611151112540
    BspCNICTCAG(9/7)758042471081010920165142
    BspDIAT/CGAT215021002000003
    BspEIT/CCGGA824001001201100
    BspHIT/CATGA382142221223313
    BspMIACCTGC(4/8)39410315454423118
    BspQIGCTCTTC(1/4)710001332131114
    BsrBICCGCTC(-3/-3)28173426764695317
    BsrDIGCAATG(2/0)14442324374444218
    BsrFIR/CCGGY40612176692611913
    BsrGIT/GTACA550100010112013
    BsrIACTGG(1/-1)861101119181714232619322811118
    BssHIIG/CGCGC526100111221101
    BssKI/CCNGG23318591116282425272846291211
    BssSICACGAG(-5/-1)1182035453424331
    BstAPIGCANNNN/NTGC20340022232032112
    BstBITT/CGAA17100112000107
    BstEII G/GTNACC1013000101101101
    BstEII-HF®G/GTNACC
    BstNICC/WGG136715761914151419191452
    BstUICG/CG303157111723151726311941351065
    BstXICCANNNNN/NTGG10130002024143011
    BstYIR/GATCY2221828161412911101272
    BstZ17IGTA/TAC33001113011108
    Bsu36ICC/TNAGG720101011100030
    BtgIC/CRYGG82461222743614026
    BtgZIGCGATG(10/14)23452437646643024
    BtsCIGGATG(2/0)7815044121611201771218597
    BtsIGCAGTG(2/0)22342124575544320
    BtsIMutICAGTG(2/0)20
    Cac8IGCN/NGC2852381228312933333241494214104
    ClaIAT/CGAT215021002000003
    CspCI(11/13)CAANNNNNGTGG(12/10)67010001010009
    CviAIIC/ATG183181914262523382321233111148
    CviKI-1RG/CY68069246103731051011318611911212145562
    CviQIG/TAC831133193113157146113168
    DdeIC/TNAG97104430811917111120196282
    DpnIGA/TC871161662238333523312429156
    DpnII/GATC871161662238333523312429156
    DraITTT/AAA1213253335163239
    DraIIICACNNN/GTG01011016
    DraIII-HF®CACNNN/GTG101011012011016
    DrdIGACNNNN/NNGTC632123352244211
    DvuIIICACNCAC
    EaeIY/GGCCR7039236810105154832
    EagIC/GGCCG192001224122200
    EagI-HF®C/GGCCG1920012412200
    EarICTCTTC(1/4)293422254116435346
    EciIGGCGGA(11/9)29323241096689832
    Eco53kIGAG/CTC162110112120110
    EcoNICCTNN/NNNAGG109001003002101
    EcoO109IRG/GNCCY4430041012513122
    EcoP15ICAGCAG(25/27)507234744710665336
    EcoRIG/AATTC55111111111110
    EcoRI-HF®G/AATTC551111111110
    EcoRVGAT/ATC921101111111300
    EcoRV-HF®GAT/ATC9211011111300
    FatI/CATG183181914262523382321233111148
    FauICCCGC(4/6)147905101010101417112822524
    Fnu4HIGC/NGC4113801617424646524247495219156
    FokIGGATG(9/13)7815044121611201771218597
    FseIGGCCGG/CC30000000000000
    FspEICC(12/16)
    FspITGC/GCA1715214223221227
    HaeIIRGCGC/Y7648461155693712326
    HaeIIIGG/CC216149121522212431233634361168
    HgaIGACGC(5/10)87102371156101272015470
    HhaIGCG/C375215192631283639414617103
    HincIIGTY/RAC25352123397476161
    HindIIIA/AGCTT126111111140210
    HindIII-HF®A/AGCTT1261111110210
    HinfIG/ANTC721486261021153191116206218
    HinP1IG/CGC3752151926313128363927414617103
    HpaIGTT/AAC6141000031112018
    HpaIIC/CGG171328121826242532252450351358
    HphIGGTGA(8/7)991689181211815191421207102
    Hpy166IIGTN/NAC11612510108141329201327245199
    Hpy188ITCN/GA801701031152420241917192810153
    Hpy188IIITC/NNGA1031851228193226322225272813173
    Hpy99ICGWCG/611025891212149131816529
    HpyAVCCTTC(6/5)8410671410161224141116206110
    HpyCH4IIIACN/GT12218773114221125201518228174
    HpyCH4IVA/CGT83143132210151121101923225170
    HpyCH4VTG/CA2072731018213228392830262713116
    I-CeuITAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)0000000
    I-SceITAGGGATAACAGGGTAAT(-9/-13)0000000
    KasIG/GCGCC201014111111412
    KpnIGGTAC/C82110110020115
    KpnI-HF®GGTAC/C821101000115
    LpnPICCDG(10/14)
    MboI/GATC871161662238333523312429156
    MboIIGAAGA(8/7)113130101011181338151414188140
    MfeIC/AATTG48000002121108
    MfeI-HF®C/AATTG480000211108
    MluCI/AATT87189862818154322193144779
    MluIA/CGCGT57000000122101
    MlyIGAGTC(5/5)406168488175611104115
    MmeITCCRAC(20/18)25183345383544233
    MnlICCTC(7/6)3972621162263530562441353913342
    MscITGG/CCA1718011120120102
    MseIT/TAA1151951563151816412423323913207
    MslICAYNN/NNRTG3562337751010679338
    MspA1ICMG/CKG957544698141181012635
    MspIC/CGG171328121826242532252450351358
    MspJICNNR(9/13)
    MwoIGCNNNNN/NNGC3913471319343338333042414313170
    NaeIGCC/GGC131014333025500
    NarIGG/CGCC201014111111412
    Nb.BbvCICCTCAGC9702000000010
    Nb.BsmIGAATGC104611113110015
    Nb.BsrDIGCAATG144423237444218
    Nb.BtsIGCAGTG223421257544320
    NciICC/SGG97114441091010139271579
    NcoIC/CATGG204100241130101
    NcoI-HF®C/CATGG2041004110101
    NdeICA/TATG27031001111117
    NgoMIVG/CCGGC131014333025500
    NheIG/CTAGC410010401101
    NheI-HF®G/CTAGC410010401101
    NlaIIICATG/183181914262523382321233111148
    NlaIVGGN/NCC17882131824251822142022301199
    NmeAIIIGCCGAG(21/19)1781033423224114
    NotIGC/GGCCGC70000111111100
    NotI-HF®GC/GGCCGC700001111100
    NruITCG/CGA55001011011003
    NsiIATGCA/T914100336010008
    NspIRCATG/Y41321647693555324
    Nt.AlwIGGATC(4/-5)3558103122018121516101
    Nt.BbvCICCTCAGC(-5/-7)9702000000010
    Nt.BsmAIGTCTC(1/-5)60373533118810495
    Nt.BspQIGCTCTTC(1/-7)7100013211114
    Nt.BstNBIGAGTC(4/-5)406168488175611104115
    Nt.CviPII(0/-1)CCD414846412615704575955118065706097167292513575
    PacITTAAT/TAA10010000010001
    PaeR7IC/TCGAG61100121011000
    PciIA/CATGT92131213121116
    PflFIGACN/NNGTC122001211111201
    PflMICCANNNN/NTGG1814002303152208
    PhoIGG/CC216149121522212431233634361168
    PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)0000000
    PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)0000000
    PleIGAGTC(4/5)406168488175611104115
    PluTIGGCGC/C
    PmeIGTTT/AAAC12000000011002
    PmlICAC/GTG103000100010101
    PpuMIRG/GWCCY2330021012100012
    PshAIGACNN/NNGTC27001101001206
    PsiITTA/TAA412120222111105
    PspGI/CCWGG136715761914151419191452
    PspOMIG/GGCCC121000000111100
    PspXIVC/TCGAGB31000120011000
    PstICTGCA/G3028111223141110
    PstI-HF®CTGCA/G30281112311110
    PvuICGAT/CG7321112211220
    PvuI-HF®CGAT/CG732112321220
    PvuIICAG/CTG2415131533333423
    PvuII-HF®CAG/CTG24151313333423
    RsaIGT/AC831133193113157146113168
    RsrIICG/GWCCG25000110110001
    SacIGAGCT/C1621101212120110
    SacI-HF®GAGCT/C1621101210110
    SacIICCGC/GG334000012011100
    SalIG/TCGAC32011131114110
    SalI-HF®G/TCGAC320113114110
    SapIGCTCTTC(1/4)710001332131114
    Sau3AI/GATC871161662238333523312429156
    Sau96IG/GNCC164746415781420212624679
    SbfICCTGCA/GG3511000110110
    SbfI-HF®CCTGCA/GG351100110110
    ScaIAGT/ACT1111214
    ScaI-HF®AGT/ACT551011211214
    ScrFICC/NGG23318591116282425272846291211
    SexAIA/CCWGGT95000213000000
    SfaNIGCATC(5/9)85169572220191820172319896
    SfcIC/TRYAG473877496941068448
    SfiIGGCCNNNN/NGGCC30000000010001
    SfoIGGC/GCC201014111111412
    SgrAICR/CCGGYG66001000001100
    SmaICCC/GGG123010111010010
    SmlIC/TYRAG291754678851089475
    SnaBITAC/GTA011100010100013
    SpeIA/CTAGT30000000011102
    SpeI-HF®A/CTAGT
    SphI-HF®GCATG/C860115202110
    SphIGCATG/C86011452022110
    SspIAAT/ATT520361116213516
    SspI-HF®AAT/ATT5203611623516
    StuIAGG/CCT116100111001101
    StyD4I/CCNGG23318591116282425272846291211
    StyIC/CWWGG44102015541424036
    StyI-HF®C/CWWGG441020154124036
    SwaIATTT/AAAT10110000011101
    TaqαIT/CGA501215127171732161522174111
    TfiIG/AWTC3287018613714455102103
    TliIC/TCGAG0101000
    TseIG/CWGC179199910212223272520272912116
    Tsp45I/GTSAC73816998697512134108
    Tsp509I/AATT843223133779
    TspMIC/CCGGG123010111010010
    TspRINNCASTGNN/831197911151222141616151094
    Tth111IGACN/NNGTC122001211111201
    XbaIT/CTAGA51110111011113
    XcmICCANNNNN/NNNNTGG1412000101303408
    XhoIC/TCGAG61100121011000
    XmaIC/CCGGG123010111010010
    XmnIGAANN/NNTTC5240223431372112
    ZraIGAC/GTC310101110051011