New England Biolabs: Reagents for the Life Sciences Industry

Frequencies of Restriction Sites

The table below summarizes the frequencies with which restriction endonuclease sites occur in commonly used DNA molecules. Detailed restriction maps can be found on DNA sequences and maps. The sites listed in these tables were identified by computer analysis of published sequences. Although we have tried to ensure their accuracy, the sites have not necessarily been confirmed by experimentation. When the same specificity is displayed by several enzymes, the site is listed by the name of the enzyme that is available from New England Biolabs. Other enzymes with the same specificity are listed in the table of isoschizomers. Recognition sequences are written 5´ to 3´.

EnzymeRecognition SequenceAdeno-2LambdaLITMUS28iM13mp18pBR322pGLuc-Basic2pGLuc-BasicpKLAC2pMAL-p5xpSNAPfpTXB1pTYB21pUC19T7
AatIIGACGT/C310101110051011
AbaSI
Acc65IG/GTACC82110110020115
AccIGT/MKAC1790123351253133
AciICCGC(-3/-1)58251627426766648180751029234199
AclIAA/CGTT3732422253129219
AcuICTGAAG(16/14)2340202948452221
AfeIAGC/GCT132014000201200
AflIIC/TTAAG430000000000019
AflIIIA/CRYGT25201315142534123
AgeI §A/CCGGT513100001011002
AgeI-HF®A/CCGGT5131000101002
AhdIGACNNN/NNGTC992011212122114
AleICACNN/NNGTG1020010001010208
AluIAG/CT1581431527173125382827303416140
AlwIGGATC(4/5)35581031221201812201516101
AlwNICAGNNN/CTG25411112252412115
ApaIGGGCC/C121000000111100
ApaLIG/TGCAC74203233644431
ApeKIG/CWGC179199910212223272520272912116
ApoI §R/AATTY2958311033195357113
ApoI-HFR/AATTY29
AscIGG/CGCGCC22000000010000
AseIAT/TAAT31717144547104312
AsiSIGCGAT/CGC10000000000000
AvaIC/YCGRG408221232123114
AvaIIG/GWCC73352184379668254
AvrIIC/CTAGG22100110010003
BaeGIGKGCM/C45102134588865316
BaeI(10/15)ACNNNNGTAYC(12/7)510130101000103
BamHI §G/GATCC35111111111110
BamHI-HF®G/GATCC351111111110
BanIG/GYRCC572547976748812433
BanIIGRGCY/C577222565253611
BbsI §GAAGAC(2/6)27240032133244038
BbsI-HF®GAAGAC(2/6)24
BbvCICCTCAGC(-5/-2)970200000000010
BbvIGCAGC(8/12)179199910212223272520272912116
BccICCATC(4/5)62145514925112216814253121
BceAIACGGC(12/14)8011537375131181310247
BcgI(10/12)CGANNNNNNTGC(12/10)10281031164146119
BciVIGTATCC(6/5)9262024434344223
BclIT/GATCA58000212211201
BcoDIGTCTC(1/5)603735393118489495
BfaIC/TAG541375512101931488460
BfuAIACCTGC(4/8)39410315454423118
BfuCI/GATC871161662238333523312429156
BglIGCCNNNN/NGGC2029213113172322
BglIIA/GATCT116110311120201
BlpIGC/TNAGC860000001011020
BmgBICACGTC(-3/-3)1517000101120008
BmrIACTGGG(5/4)22421532511826
BmtI §GCTAG/C41001004011101
BmtI-HF®GCTAG/C
BpmICTGGAG(16/14)32251246434156123
Bpu10ICCTNAGC(-5/-2)23190410001202039
BpuEICTTGAG(16/14)19134466675979456
BsaAIYAC/GTR22142514240324035
BsaBIGATNN/NNATC221021422211307
BsaHIGR/CGYC44402165565812738
BsaI §GGTCTC(1/5)1821011132222129
BsaI-HF®GGTCTC(1/5)18210113222129
BsaJIC/CNNGG23410569816211810171515585
BsaWIW/CCGGW28814654487586332
BsaXI(9/12)ACNNNNNCTCC(10/7)29191404331123112
BseRIGAGGAG(10/8)63190102120300013
BseYICCCAGC(-5/-1)31321325534544129
BsgIGTGCAG(16/14)34410011346354021
BsiEICGRY/CG502243767118698517
BsiHKAIGWGCW/C38284386889977524
BsiWI §C/GTACG41100000101000
BsiWI-HF®C/GTACG4
BslICCNNNNN/NNGG2161768172021151816263125690
BsmAIGTCTC(1/5)60373533118810495
BsmBICGTCTC(1/5)21141112022022216
BsmFIGGGAC(10/14)59380249741546046
BsmIGAATGC(1/-1)10461114131510015
BsoBIC/YCGRG408221232123114
Bsp1286IGDGCH/C10538551012151611151112540
BspCNICTCAG(9/7)758042471081010920165142
BspDIAT/CGAT215021002000003
BspEIT/CCGGA824001001201100
BspHIT/CATGA382142221223313
BspMIACCTGC(4/8)39410315454423118
BspQIGCTCTTC(1/4)710001332131114
BsrBICCGCTC(-3/-3)28173426764695317
BsrDIGCAATG(2/0)14442324374444218
BsrFαIR/CCGGY40612176692611913
BsrFIR/CCGGY40612176692611913
BsrGI §T/GTACA550100010112013
BsrGI-HF®T/GTACA
BsrIACTGG(1/-1)861101119181714232619322811118
BssHIIG/CGCGC526100111221101
BssKI/CCNGG23318591116282425272846291211
BssSαICACGAG(-5/-1)
BssSICACGAG(-5/-1)1182035453424331
BstAPIGCANNNN/NTGC20340022232032112
BstBITT/CGAA17100112000107
BstEII  §G/GTNACC1013000101101101
BstEII-HF®G/GTNACC
BstNICC/WGG136715761914151419191452
BstUICG/CG303157111723151726311941351065
BstXICCANNNNN/NTGG10130002024143011
BstYIR/GATCY2221828161412911101272
BstZ17I §GTA/TAC33001113011108
BstZ17I-HF®GTATAC330011
Bsu36ICC/TNAGG720101011100030
BtgIC/CRYGG82461222743614026
BtgZIGCGATG(10/14)23452437646643024
BtsαIGCAGTG(2/0)
BtsCIGGATG(2/0)7815044121611201771218597
BtsIGCAGTG(2/0)22342124575544320
BtsIMutICAGTG(2/0)20
Cac8IGCN/NGC2852381228312933333241494214104
ClaIAT/CGAT215021002000003
CspCI(11/13)CAANNNNNGTGG(12/10)67010001010009
CviAIIC/ATG183181914262523382321233111148
CviKI-1RG/CY68069246103731051011318611911212145562
CviQIG/TAC831133193113157146113168
DdeIC/TNAG97104430811917111120196282
DpnIGA/TC871161662238333523312429156
DpnII/GATC871161662238333523312429156
DraITTT/AAA1213253335163239
DraIII §CACNNN/GTG01011016
DraIII-HF®CACNNN/GTG101011012011016
DrdIGACNNNN/NNGTC632123352244211
EaeIY/GGCCR7039236810105154832
EagI §C/GGCCG192001224122200
EagI-HF®C/GGCCG1920012412200
EarICTCTTC(1/4)293422254116435346
EciIGGCGGA(11/9)29323241096689832
Eco53kIGAG/CTC162110112120110
EcoNICCTNN/NNNAGG109001003002101
EcoO109IRG/GNCCY4430041012513122
EcoP15ICAGCAG(25/27)507234744710665336
EcoRI §G/AATTC55111111111110
EcoRI-HF®G/AATTC551111111110
EcoRV §GAT/ATC921101111111300
EcoRV-HF®GAT/ATC9211011111300
FatI/CATG183181914262523382321233111148
FauICCCGC(4/6)147905101010101417112822524
Fnu4HIGC/NGC4113801617424646524247495219156
FokIGGATG(9/13)7815044121611201771218597
FseIGGCCGG/CC30000000000000
FspEICC(12/16)
FspITGC/GCA1715214223221227
HaeIIRGCGC/Y7648461155693712326
HaeIIIGG/CC216149121522212431233634361168
HgaIGACGC(5/10)87102371156101272015470
HhaIGCG/C375215192631283639414617103
HincIIGTY/RAC25352123397476161
HindIII §A/AGCTT126111111140210
HindIII-HF®A/AGCTT1261111110210
HinfIG/ANTC721486261021153191116206218
HinP1IG/CGC3752151926313128363927414617103
HpaIGTT/AAC6141000031112018
HpaIIC/CGG171328121826242532252450351358
HphIGGTGA(8/7)991689181211815191421207102
Hpy166IIGTN/NAC11612510108141329201327245199
Hpy188ITCN/GA801701031152420241917192810153
Hpy188IIITC/NNGA1031851228193226322225272813173
Hpy99ICGWCG/611025891212149131816529
HpyAVCCTTC(6/5)8410671410161224141116206110
HpyCH4IIIACN/GT12218773114221125201518228174
HpyCH4IVA/CGT83143132210151121101923225170
HpyCH4VTG/CA2072731018213228392830262713116
I-CeuITAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)0000000
I-SceITAGGGATAACAGGGTAAT(-9/-13)0000000
KasIG/GCGCC201014111111412
KpnI §GGTAC/C82110110020115
KpnI-HF®GGTAC/C821101000115
LpnPICCDG(10/14)
MboI/GATC871161662238333523312429156
MboIIGAAGA(8/7)113130101011181338151414188140
MfeI §C/AATTG48000002121108
MfeI-HF®C/AATTG480000211108
MluCI/AATT87189862818154322193144779
MluI §A/CGCGT57000000122101
MluI-HF®A/CGCGT
MlyIGAGTC(5/5)406168488175611104115
MmeITCCRAC(20/18)25183345383544233
MnlICCTC(7/6)3972621162263530562441353913342
MscITGG/CCA1718011120120102
MseIT/TAA1151951563151816412423323913207
MslICAYNN/NNRTG3562337751010679338
MspA1ICMG/CKG957544698141181012635
MspIC/CGG171328121826242532252450351358
MspJICNNR(9/13)
MwoIGCNNNNN/NNGC3913471319343338333042414313170
NaeIGCC/GGC131014333025500
NarIGG/CGCC201014111111412
Nb.BbvCICCTCAGC9702000000010
Nb.BsmIGAATGC104611113110015
Nb.BsrDIGCAATG144423237444218
Nb.BssSICACGAG118203545324331
Nb.BtsIGCAGTG223421257544320
NciICC/SGG97114441091010139271579
NcoI §C/CATGG204100241130101
NcoI-HF®C/CATGG2041004110101
NdeICA/TATG27031001111117
NgoMIVG/CCGGC131014333025500
NheI §G/CTAGC410010401101
NheI-HF®G/CTAGC410010401101
NlaIIICATG/183181914262523382321233111148
NlaIVGGN/NCC17882131824251822142022301199
NmeAIIIGCCGAG(21/19)1781033423224114
NotI §GC/GGCCGC70000111111100
NotI-HF®GC/GGCCGC700001111100
NruI §TCG/CGA55001011011003
NruI-HF®TCG/CGA
NsiI §ATGCA/T914100336010008
NsiI-HF®ATGCA/T
NspIRCATG/Y41321647693555324
Nt.AlwIGGATC(4/-5)3558103122018121516101
Nt.BbvCICCTCAGC(-5/-7)9702000000010
Nt.BsmAIGTCTC(1/-5)60373533118810495
Nt.BspQIGCTCTTC(1/-7)7100013211114
Nt.BstNBIGAGTC(4/-5)406168488175611104115
Nt.CviPII(0/-1)CCD414846412615704575955118065706097167292513575
PacITTAAT/TAA10010000010001
PaeR7IC/TCGAG61100121011000
PciIA/CATGT92131213121116
PflFIGACN/NNGTC122001211111201
PflMICCANNNN/NTGG1814002303152208
PhoIGG/CC216149121522212431233634361168
PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)0000000
PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)0000000
PleIGAGTC(4/5)406168488175611104115
PluTIGGCGC/C
PmeIGTTT/AAAC12000000011002
PmlICAC/GTG103000100010101
PpuMIRG/GWCCY2330021012100012
PshAIGACNN/NNGTC27001101001206
PsiITTA/TAA412120222111105
PspGI/CCWGG136715761914151419191452
PspOMIG/GGCCC121000000111100
PspXIVC/TCGAGB31000120011000
PstI §CTGCA/G3028111223141110
PstI-HF®CTGCA/G30281112311110
PvuI §CGAT/CG7321112211220
PvuI-HF®CGAT/CG732112321220
PvuII §CAG/CTG2415131533333423
PvuII-HF®CAG/CTG24151313333423
RsaIGT/AC831133193113157146113168
RsrIICG/GWCCG25000110110001
SacI §GAGCT/C1621101212120110
SacI-HF®GAGCT/C1621101210110
SacIICCGC/GG334000012011100
SalI §G/TCGAC32011131114110
SalI-HF®G/TCGAC320113114110
SapIGCTCTTC(1/4)710001332131114
Sau3AI/GATC871161662238333523312429156
Sau96IG/GNCC164746415781420212624679
SbfI §CCTGCA/GG3511000110110
SbfI-HF®CCTGCA/GG351100110110
ScaI §AGT/ACT1111214
ScaI-HF®AGT/ACT551011211214
ScrFICC/NGG23318591116282425272846291211
SexAIA/CCWGGT95000213000000
SfaNIGCATC(5/9)85169572220191820172319896
SfcIC/TRYAG473877496941068448
SfiIGGCCNNNN/NGGCC30000000010001
SfoIGGC/GCC201014111111412
SgrAICR/CCGGYG66001000001100
SmaICCC/GGG123010111010010
SmlIC/TYRAG291754678851089475
SnaBITAC/GTA011100010100013
SpeI §A/CTAGT30000000011102
SpeI-HF®A/CTAGT
SphI §GCATG/C86011452022110
SphI-HF®GCATG/C860115202110
SrfIGCCC/GGGC
SspI §AAT/ATT520361116213516
SspI-HF®AAT/ATT5203611623516
StuIAGG/CCT116100111001101
StyD4I/CCNGG23318591116282425272846291211
StyI §C/CWWGG44102015541424036
StyI-HF®C/CWWGG441020154124036
SwaIATTT/AAAT10110000011101
TaqαIT/CGA501215127171732161522174111
TfiIG/AWTC3287018613714455102103
TliIC/TCGAG0101000
TseIG/CWGC179199910212223272520272912116
Tsp45I/GTSAC73816998697512134108
Tsp509I/AATT843223133779
TspMIC/CCGGG123010111010010
TspRINNCASTGNN/831197911151222141616151094
Tth111IGACN/NNGTC122001211111201
XbaIT/CTAGA51110111011113
XcmICCANNNNN/NNNNTGG1412000101303408
XhoIC/TCGAG61100121011000
XmaIC/CCGGG123010111010010
XmnIGAANN/NNTTC5240223431372112
ZraIGAC/GTC310101110051011