Enzymes with Nonpalindromic Sequences

  • My NEB
  • Print
  • PDF
  • All recognition sequences are written 5' to 3' using the single letter code nomenclature. Numbers in parentheses indicate the point of cleavage.

    Example, GGTCTC(1/5) indicates cleavage at:
    5'...GGTCTCN/...3'
    3'...CCAGAGNNNN/...5'

    EnzymeRecognition Sequence
    AciICCGC(-3/-1)
    AcuICTGAAG(16/14)
    AlwIGGATC(4/5)
    BaeI(10/15)ACNNNNGTAYC(12/7)
    BbsIGAAGAC(2/6)
    BbvCICCTCAGC(-5/-2)
    BbvIGCAGC(8/12)
    BccICCATC(4/5)
    BceAIACGGC(12/14)
    BcgI(10/12)CGANNNNNNTGC(12/10)
    BciVIGTATCC(6/5)
    BcoDIGTCTC(1/5)
    BfuAIACCTGC(4/8)
    BmgBICACGTC(-3/-3)
    BmrIACTGGG(5/4)
    BpmICTGGAG(16/14)
    Bpu10ICCTNAGC(-5/-2)
    BpuEICTTGAG(16/14)
    BsaIGGTCTC(1/5)
    BsaI-HF®GGTCTC(1/5)
    BsaXI(9/12)ACNNNNNCTCC(10/7)
    BseRIGAGGAG(10/8)
    BseYICCCAGC(-5/-1)
    BsgIGTGCAG(16/14)
    BsmAIGTCTC(1/5)
    BsmBICGTCTC(1/5)
    BsmFIGGGAC(10/14)
    BsmIGAATGC(1/-1)
    BspCNICTCAG(9/7)
    BspMIACCTGC(4/8)
    BspQIGCTCTTC(1/4)
    BsrBICCGCTC(-3/-3)
    BsrDIGCAATG(2/0)
    BsrIACTGG(1/-1)
    BssSICACGAG(-5/-1)
    BtgZIGCGATG(10/14)
    BtsCIGGATG(2/0)
    BtsIGCAGTG(2/0)
    BtsIMutICAGTG(2/0)
    CspCI(11/13)CAANNNNNGTGG(12/10)
    DvuIIICACNCAC
    EarICTCTTC(1/4)
    EciIGGCGGA(11/9)
    EcoP15ICAGCAG(25/27)
    FauICCCGC(4/6)
    FokIGGATG(9/13)
    FspEICC(12/16)
    HgaIGACGC(5/10)
    HphIGGTGA(8/7)
    HpyAVCCTTC(6/5)
    I-CeuITAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
    I-SceITAGGGATAACAGGGTAAT(-9/-13)
    LpnPICCDG(10/14)
    MboIIGAAGA(8/7)
    MlyIGAGTC(5/5)
    MmeITCCRAC(20/18)
    MnlICCTC(7/6)
    MspJICNNR(9/13)
    Nb.BbvCICCTCAGC
    Nb.BsmIGAATGC
    Nb.BsrDIGCAATG
    Nb.BtsIGCAGTG
    NmeAIIIGCCGAG(21/19)
    Nt.AlwIGGATC(4/-5)
    Nt.BbvCICCTCAGC(-5/-7)
    Nt.BsmAIGTCTC(1/-5)
    Nt.BspQIGCTCTTC(1/-7)
    Nt.BstNBIGAGTC(4/-5)
    Nt.CviPII(0/-1)CCD
    PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
    PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
    PleIGAGTC(4/5)
    SapIGCTCTTC(1/4)
    SfaNIGCATC(5/9)