Dam-Dcm and CpG Methylation

  • My NEB
  • Print
  • PDF
  • DNA methyltransferases (MTases) that transfer a methyl group from S-adenosylmethionine to either adenine or cytosine residues, are found in a wide variety of prokaryotes and eukaryotes. Methylation should be considered when digesting DNA with restriction endonucleases because cleavage can be blocked or impaired when a particular base in the recognition site is methylated.

    Prokaryotic Methylation

    In prokaryotes, MTases have most often been identified as elements of restriction/modification systems that act to protect host DNA from cleavage by the corresponding restriction endonuclease. Most laboratory strains of E. coli contain three site-specific DNA methylases.

    • Dam methylase–methylation at the N6 position of the adenine in the sequence GATC (1,2).
    • Dcm methyltransferases–methylation at the C5 position of the second cytosine in the sequences CCAGG and CCTGG (1,3).
    • EcoKI methylase–methylation of adenine in the sequences AAC(N6)GTGC and GCAC(N6)GTT.

    Some or all of the sites for a restriction endonuclease may be resistant to cleavage when isolated from strains expressing the Dam or Dcm methylases if the methylase recognition site overlaps the endonuclease recognition site. For example, plasmid DNA isolated from dam+ E. coli is completely resistant to cleavage by MboI, which cleaves at GATC sites.

    Not all DNA isolated from E. coli is methylated to the same extent. While pBR322 DNA is fully modified (and is therefore completely resistant to MboI digestion), only about 50% of λ DNA Dam sites are methylated, presumably because the methylase does not have the opportunity to methylate the DNA fully before it is packaged into the phage head. As a result, enzymes blocked by Dam or Dcm modification will yield partial digestion patterns with λ DNA.

    Restriction sites that are blocked by Dam or Dcm methylation can be un-methylated by cloning your DNA into a dam, dcm strain of E. coli, such as dam/dcm Competent E. coli (NEB #C2925).

    Restriction sites can also be blocked if an overlapping site is present. In this case, part of the Dam or Dcm sequence is generated by the restriction enzyme sequence, followed by the flanking sequence. This situation should also be considered when designing restriction enzyme digests.

    Eukaryotic Methylation

    CpG MTases, found in higher eukaryotes (e.g., Dnmt1), transfer a methyl group to the C5 position of cytosine residues. Patterns of CpG methylation are heritable, tissue specific and correlate with gene expression. Consequently, CpG methylation has been postulated to play a role in differentiation and gene expression (4).

    Note: The effects of CpG methylation are mainly a concern when digesting eukaryotic genomic DNA. CpG methylation patterns are not retained once the DNA is cloned into a bacterial host.

    Methylation Sensitivity

    The table below summarizes methylation sensitivity for NEB restriction enzymes, indicating whether or not cleavage is blocked or impaired by Dam, Dcm or CpG methylation if or when it overlaps each recognition site. This table should be viewed as a guide to the behavior of the enzymes listed rather than an absolute indicator. Consult REBASE , the restriction enzyme database, for more detailed information and specific examples upon which these guidelines are based.

    References

    1. Marinus, M.G. and Morris, N.R. (1973) J. Bacteriol. 114, 1143–1150. PMID: 4576399
    2. Geier, G.E.and Modrich, P. (1979) J. Biol. Chem. 254, 1408–1413. PMID: 368070
    3. May, M.S. and Hattman, S.(1975) J. Bacteriol. 123, 768–770. PMID: 1097428
    4. Siegfried, Z. and Cedar, H. (1997) Curr. Biol. 7, r305–307. PMID: 9115385

    Legend

    Not Sensitive   Impaired
    Blocked Impaired by Overlapping
    Blocked by Overlapping Impaired by Some Combinations of Overlapping
    Blocked by Some Combinations of Overlapping
    Single Letter Code
    EnzymeSequenceDamDcmCpG
    AatIIGACGT/CNot SensitiveNot SensitiveBlocked
    AbaSINot SensitiveNot SensitiveNot Sensitive
    Acc65IG/GTACCNot SensitiveBlocked by Some Combinations of OverlappingBlocked by Some Combinations of Overlapping
    AccIGT/MKACNot SensitiveNot SensitiveBlocked by Overlapping
    AciICCGC(-3/-1)Not SensitiveNot SensitiveBlocked
    AclIAA/CGTTNot SensitiveNot SensitiveBlocked
    AcuICTGAAG(16/14)Not SensitiveNot SensitiveNot Sensitive
    AfeIAGC/GCTNot SensitiveNot SensitiveBlocked
    AflIIC/TTAAGNot SensitiveNot SensitiveNot Sensitive
    AflIIIA/CRYGTNot SensitiveNot SensitiveNot Sensitive
    AgeIA/CCGGTNot SensitiveNot SensitiveBlocked
    AgeI-HFA/CCGGTNot SensitiveNot SensitiveBlocked
    AgeI-HF® RE-Mix®A/CCGGTNot SensitiveNot SensitiveBlocked
    AhdIGACNNN/NNGTCNot SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
    AleICACNN/NNGTGNot SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
    AluIAG/CTNot SensitiveNot SensitiveNot Sensitive
    AlwIGGATC(4/5)BlockedNot SensitiveNot Sensitive
    AlwNICAGNNN/CTGNot SensitiveBlocked by OverlappingNot Sensitive
    ApaIGGGCC/CNot SensitiveBlocked by OverlappingBlocked by Overlapping
    ApaLIG/TGCACNot SensitiveNot SensitiveBlocked by Overlapping
    ApeKIG/CWGCNot SensitiveNot Sensitive
    ApoIR/AATTYNot SensitiveNot SensitiveNot Sensitive
    AscIGG/CGCGCCNot SensitiveNot SensitiveBlocked
    AscI RE-Mix®GG/CGCGCCNot SensitiveNot SensitiveBlocked
    AseIAT/TAATNot SensitiveNot SensitiveNot Sensitive
    AsiSIGCGAT/CGCNot SensitiveNot SensitiveBlocked
    AvaIC/YCGRGNot SensitiveNot SensitiveBlocked
    AvaIIG/GWCCNot SensitiveBlocked by OverlappingBlocked by Overlapping
    AvrIIC/CTAGGNot SensitiveNot SensitiveNot Sensitive
    EnzymeBack to topSequenceDamDcmCpG
    BaeGIGKGCM/CNot SensitiveNot SensitiveNot Sensitive
    BaeI(10/15)ACNNNNGTAYC(12/7)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    BamHIG/GATCCNot SensitiveNot SensitiveNot Sensitive
    BamHI-HF®G/GATCCNot SensitiveNot SensitiveNot Sensitive
    BanIG/GYRCCNot SensitiveBlocked by Some Combinations of OverlappingBlocked by Some Combinations of Overlapping
    BanIIGRGCY/CNot SensitiveNot SensitiveNot Sensitive
    BbsIGAAGAC(2/6)Not SensitiveNot SensitiveNot Sensitive
    BbvCICCTCAGC(-5/-2)Not SensitiveNot SensitiveImpaired by Overlapping
    BbvIGCAGC(8/12)Not SensitiveNot SensitiveNot Sensitive
    BccICCATC(4/5)Not SensitiveNot SensitiveNot Sensitive
    BceAIACGGC(12/14)Not SensitiveNot SensitiveBlocked
    BcgI(10/12)CGANNNNNNTGC(12/10)Impaired by Overlapping Not SensitiveBlocked by Some Combinations of Overlapping
    BciVIGTATCC(6/5)Not SensitiveNot SensitiveNot Sensitive
    BclIT/GATCABlockedNot SensitiveNot Sensitive
    BcoDIGTCTC(1/5)Not SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
    BfaIC/TAGNot SensitiveNot SensitiveNot Sensitive
    BfuAIACCTGC(4/8)Not SensitiveNot SensitiveImpaired by Overlapping
    BfuCI/GATCNot SensitiveNot SensitiveBlocked by Overlapping
    BglIGCCNNNN/NGGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    BglIIA/GATCTNot SensitiveNot SensitiveNot Sensitive
    BlpIGC/TNAGCNot SensitiveNot SensitiveNot Sensitive
    BmgBICACGTC(-3/-3)Not SensitiveNot SensitiveBlocked
    BmrIACTGGG(5/4)Not SensitiveNot SensitiveNot Sensitive
    BmtIGCTAG/CNot SensitiveNot SensitiveNot Sensitive
    BmtI-HF®GCTAG/CNot SensitiveNot SensitiveNot Sensitive
    BpmICTGGAG(16/14)Not SensitiveNot SensitiveNot Sensitive
    Bpu10ICCTNAGC(-5/-2)Not SensitiveNot SensitiveNot Sensitive
    BpuEICTTGAG(16/14)Not SensitiveNot SensitiveNot Sensitive
    BsaAIYAC/GTRNot SensitiveNot SensitiveBlocked
    BsaBIGATNN/NNATCBlocked by OverlappingNot SensitiveBlocked by Some Combinations of Overlapping
    BsaHIGR/CGYCNot SensitiveBlocked by Some Combinations of OverlappingBlocked
    BsaIGGTCTC(1/5)Not SensitiveBlocked by OverlappingBlocked by Some Combinations of Overlapping
    BsaI-HF®GGTCTC(1/5)Not SensitiveBlocked by OverlappingBlocked by Some Combinations of Overlapping
    BsaJIC/CNNGGNot SensitiveNot SensitiveNot Sensitive
    BsaWIW/CCGGWNot SensitiveNot SensitiveNot Sensitive
    BsaXI(9/12)ACNNNNNCTCC(10/7)Not SensitiveNot SensitiveNot Sensitive
    BseRIGAGGAG(10/8)Not SensitiveNot SensitiveNot Sensitive
    BseYICCCAGC(-5/-1)Not SensitiveNot SensitiveBlocked by Overlapping
    BsgIGTGCAG(16/14)Not SensitiveNot SensitiveNot Sensitive
    BsiEICGRY/CGNot SensitiveNot SensitiveBlocked
    BsiHKAIGWGCW/CNot SensitiveNot SensitiveNot Sensitive
    BsiWIC/GTACGNot SensitiveNot SensitiveBlocked
    BslICCNNNNN/NNGGNot SensitiveBlocked by Some Combinations of OverlappingBlocked by Some Combinations of Overlapping
    BsmAIGTCTC(1/5)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    BsmBICGTCTC(1/5)Not SensitiveNot SensitiveBlocked
    BsmFIGGGAC(10/14)Not SensitiveBlocked by OverlappingBlocked by Overlapping
    BsmIGAATGC(1/-1)Not SensitiveNot SensitiveNot Sensitive
    BsoBIC/YCGRGNot SensitiveNot SensitiveNot Sensitive
    Bsp1286IGDGCH/CNot SensitiveNot SensitiveNot Sensitive
    BspCNICTCAG(9/7)Not SensitiveNot SensitiveNot Sensitive
    BspDIAT/CGATBlocked by OverlappingNot SensitiveBlocked
    BspEIT/CCGGABlocked by OverlappingNot SensitiveImpaired
    BspHIT/CATGABlocked by OverlappingNot SensitiveNot Sensitive
    BspMIACCTGC(4/8)Not SensitiveNot SensitiveNot Sensitive
    BspQIGCTCTTC(1/4)Not SensitiveNot SensitiveNot Sensitive
    BsrBICCGCTC(-3/-3)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    BsrDIGCAATG(2/0)Not SensitiveNot SensitiveNot Sensitive
    BsrFIR/CCGGYNot SensitiveNot SensitiveBlocked
    BsrGIT/GTACANot SensitiveNot SensitiveNot Sensitive
    BsrIACTGG(1/-1)Not SensitiveNot SensitiveNot Sensitive
    BssHIIG/CGCGCNot SensitiveNot SensitiveBlocked
    BssKI/CCNGGNot SensitiveBlocked by OverlappingBlocked by Overlapping
    BssSICACGAG(-5/-1)Not SensitiveNot SensitiveNot Sensitive
    BstAPIGCANNNN/NTGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    BstBITT/CGAANot SensitiveNot SensitiveBlocked
    BstEII G/GTNACCNot SensitiveNot SensitiveNot Sensitive
    BstEII-HF®G/GTNACCNot SensitiveNot SensitiveNot Sensitive
    BstEII-HF® RE-Mix®G/GTNACCNot SensitiveNot SensitiveNot Sensitive
    BstNICC/WGGNot SensitiveNot SensitiveNot Sensitive
    BstUICG/CGNot SensitiveNot SensitiveBlocked
    BstXICCANNNNN/NTGGNot SensitiveBlocked by Some Combinations of OverlappingNot Sensitive
    BstYIR/GATCYNot SensitiveNot SensitiveNot Sensitive
    BstZ17IGTA/TACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    Bsu36ICC/TNAGGNot SensitiveNot SensitiveNot Sensitive
    BtgIC/CRYGGNot SensitiveNot SensitiveNot Sensitive
    BtgZIGCGATG(10/14)Not SensitiveNot SensitiveImpaired
    BtsCIGGATG(2/0)Not SensitiveNot SensitiveNot Sensitive
    BtsIGCAGTG(2/0)Not SensitiveNot SensitiveNot Sensitive
    BtsIMutICAGTG(2/0)Not SensitiveNot SensitiveNot Sensitive
    EnzymeBack to topSequenceDamDcmCpG
    Cac8IGCN/NGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    ClaIAT/CGATBlocked by OverlappingNot SensitiveBlocked
    CspCI(11/13)CAANNNNNGTGG(12/10)Not SensitiveNot SensitiveNot Sensitive
    CviAIIC/ATGNot SensitiveNot SensitiveNot Sensitive
    CviKI-1RG/CYNot SensitiveNot SensitiveNot Sensitive
    CviQIG/TACNot SensitiveNot SensitiveNot Sensitive
    EnzymeBack to topSequenceDamDcmCpG
    DdeIC/TNAGNot SensitiveNot SensitiveNot Sensitive
    DpnIGA/TCNot SensitiveNot SensitiveBlocked by Overlapping
    DpnII/GATCBlockedNot SensitiveNot Sensitive
    DraITTT/AAANot SensitiveNot SensitiveNot Sensitive
    DraIIICACNNN/GTGNot SensitiveNot SensitiveImpaired by Overlapping
    DraIII-HF®CACNNN/GTGNot SensitiveNot SensitiveImpaired by Overlapping
    DrdIGACNNNN/NNGTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    DvuIIICACNCAC
    EnzymeBack to topSequenceDamDcmCpG
    EaeIY/GGCCRNot SensitiveBlocked by OverlappingBlocked by Overlapping
    EagIC/GGCCGNot SensitiveNot SensitiveBlocked
    EagI-HF®C/GGCCGNot SensitiveNot SensitiveBlocked
    EarICTCTTC(1/4)Not SensitiveNot SensitiveImpaired by Overlapping
    EciIGGCGGA(11/9)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    Eco53kIGAG/CTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    EcoNICCTNN/NNNAGGNot SensitiveNot SensitiveNot Sensitive
    EcoO109IRG/GNCCYNot SensitiveBlocked by OverlappingNot Sensitive
    EcoP15ICAGCAG(25/27)Not SensitiveNot SensitiveNot Sensitive
    EcoRIG/AATTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    EcoRI-HF®G/AATTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    EcoRI-HF® RE-Mix®G/AATTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    EcoRVGAT/ATCNot SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
    EcoRV-HF®GAT/ATCNot SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
    EcoRV-HF® RE-Mix®GAT/ATCNot SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
    EnzymeBack to topSequenceDamDcmCpG
    FatI/CATGNot SensitiveNot SensitiveNot Sensitive
    FauICCCGC(4/6)Not SensitiveNot SensitiveBlocked
    Fnu4HIGC/NGCNot SensitiveNot SensitiveBlocked by Overlapping
    FokIGGATG(9/13)Not SensitiveImpaired by Overlapping Impaired by Overlapping
    FseIGGCCGG/CCNot SensitiveImpaired by Some Combinations of OverlappingBlocked
    FspEICC(12/16)Not SensitiveNot SensitiveNot Sensitive
    FspITGC/GCANot SensitiveNot SensitiveBlocked
    EnzymeBack to topSequenceDamDcmCpG
    HaeIIRGCGC/YNot SensitiveNot SensitiveBlocked
    HaeIIIGG/CCNot SensitiveNot SensitiveNot Sensitive
    HgaIGACGC(5/10)Not SensitiveNot SensitiveBlocked
    HhaIGCG/CNot SensitiveNot SensitiveBlocked
    HincIIGTY/RACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    HindIIIA/AGCTTNot SensitiveNot SensitiveNot Sensitive
    HindIII-HF®A/AGCTTNot SensitiveNot SensitiveNot Sensitive
    HinfIG/ANTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    HinP1IG/CGCNot SensitiveNot SensitiveBlocked
    HpaIGTT/AACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    HpaIIC/CGGNot SensitiveNot SensitiveBlocked
    HphIGGTGA(8/7)Blocked by OverlappingNot SensitiveNot Sensitive
    Hpy166IIGTN/NACNot SensitiveNot SensitiveBlocked by Overlapping
    Hpy188ITCN/GABlocked by Some Combinations of OverlappingNot SensitiveNot Sensitive
    Hpy188IIITC/NNGABlocked by OverlappingNot SensitiveBlocked by Overlapping
    Hpy99ICGWCG/Not SensitiveNot SensitiveBlocked
    HpyAVCCTTC(6/5)Not SensitiveNot SensitiveImpaired by Overlapping
    HpyCH4IIIACN/GTNot SensitiveNot SensitiveNot Sensitive
    HpyCH4IVA/CGTNot SensitiveNot SensitiveBlocked
    HpyCH4VTG/CANot SensitiveNot SensitiveNot Sensitive
    EnzymeBack to topSequenceDamDcmCpG
    I-CeuITAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
    I-SceITAGGGATAACAGGGTAAT(-9/-13)
    EnzymeBack to topSequenceDamDcmCpG
    KasIG/GCGCCNot SensitiveNot SensitiveBlocked
    KpnIGGTAC/CNot SensitiveNot SensitiveNot Sensitive
    KpnI-HF®GGTAC/CNot SensitiveNot SensitiveNot Sensitive
    KpnI-HF® RE-Mix®GGTAC/CNot SensitiveNot SensitiveNot Sensitive
    EnzymeBack to topSequenceDamDcmCpG
    LpnPICCDG(10/14)Not SensitiveNot SensitiveNot Sensitive
    EnzymeBack to topSequenceDamDcmCpG
    MboI/GATCBlockedNot SensitiveImpaired by Overlapping
    MboIIGAAGA(8/7)Blocked by OverlappingNot SensitiveNot Sensitive
    MfeIC/AATTGNot SensitiveNot SensitiveNot Sensitive
    MfeI-HF®C/AATTGNot SensitiveNot SensitiveNot Sensitive
    MfeI-HF® RE-Mix®C/AATTGNot SensitiveNot SensitiveNot Sensitive
    MluCI/AATTNot SensitiveNot SensitiveNot Sensitive
    MluIA/CGCGTNot SensitiveNot SensitiveBlocked
    MlyIGAGTC(5/5)Not SensitiveNot SensitiveNot Sensitive
    MmeITCCRAC(20/18)Not SensitiveNot SensitiveBlocked by Overlapping
    MnlICCTC(7/6)Not SensitiveNot SensitiveNot Sensitive
    MscITGG/CCANot SensitiveBlocked by OverlappingNot Sensitive
    MseIT/TAANot SensitiveNot SensitiveNot Sensitive
    MslICAYNN/NNRTGNot SensitiveNot SensitiveNot Sensitive
    MspA1ICMG/CKGNot SensitiveNot SensitiveBlocked by Overlapping
    MspIC/CGGNot SensitiveNot SensitiveNot Sensitive
    MspJICNNR(9/13)Not SensitiveNot SensitiveNot Sensitive
    MwoIGCNNNNN/NNGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    EnzymeBack to topSequenceDamDcmCpG
    NaeIGCC/GGCNot SensitiveNot SensitiveBlocked
    NarIGG/CGCCNot SensitiveNot SensitiveBlocked
    Nb.BbvCICCTCAGCNot SensitiveNot SensitiveNot Sensitive
    Nb.BsmIGAATGCNot SensitiveNot SensitiveNot Sensitive
    Nb.BsrDIGCAATGNot SensitiveNot SensitiveNot Sensitive
    Nb.BtsIGCAGTGNot SensitiveNot SensitiveNot Sensitive
    NciICC/SGGNot SensitiveNot SensitiveImpaired by Overlapping
    NcoIC/CATGGNot SensitiveNot SensitiveNot Sensitive
    NcoI-HF®C/CATGGNot SensitiveNot SensitiveNot Sensitive
    NcoI-HF® RE-Mix®C/CATGGNot SensitiveNot SensitiveNot Sensitive
    NdeICA/TATGNot SensitiveNot SensitiveNot Sensitive
    NgoMIVG/CCGGCNot SensitiveNot SensitiveBlocked
    NheIG/CTAGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    NheI-HF®G/CTAGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    NheI-HF® RE-Mix®G/CTAGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    NlaIIICATG/Not SensitiveNot SensitiveNot Sensitive
    NlaIVGGN/NCCNot SensitiveBlocked by OverlappingBlocked by Overlapping
    NmeAIIIGCCGAG(21/19)Not SensitiveNot SensitiveNot Sensitive
    NotIGC/GGCCGCNot SensitiveNot SensitiveBlocked
    NotI-HF®GC/GGCCGCNot SensitiveNot SensitiveBlocked
    NotI-HF® RE-Mix® GC/GGCCGCNot SensitiveNot SensitiveBlocked
    NruITCG/CGABlocked by OverlappingNot SensitiveBlocked
    NsiIATGCA/TNot SensitiveNot SensitiveNot Sensitive
    NspIRCATG/YNot SensitiveNot SensitiveNot Sensitive
    Nt.AlwIGGATC(4/-5)BlockedNot SensitiveNot Sensitive
    Nt.BbvCICCTCAGC(-5/-7)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    Nt.BsmAIGTCTC(1/-5)Not SensitiveNot SensitiveBlocked
    Nt.BspQIGCTCTTC(1/-7)Not SensitiveNot SensitiveNot Sensitive
    Nt.BstNBIGAGTC(4/-5)Not SensitiveNot SensitiveNot Sensitive
    Nt.CviPII(0/-1)CCDNot SensitiveNot SensitiveBlocked
    EnzymeBack to topSequenceDamDcmCpG
    PacITTAAT/TAANot SensitiveNot SensitiveNot Sensitive
    PacI RE-Mix®TTAAT/TAANot SensitiveNot SensitiveNot Sensitive
    PaeR7IC/TCGAGNot SensitiveNot SensitiveBlocked
    PciIA/CATGTNot SensitiveNot SensitiveNot Sensitive
    PflFIGACN/NNGTCNot SensitiveNot SensitiveNot Sensitive
    PflMICCANNNN/NTGGNot SensitiveBlocked by OverlappingNot Sensitive
    PhoIGG/CCNot SensitiveImpaired by Some Combinations of OverlappingImpaired by Some Combinations of Overlapping
    PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
    PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
    PleIGAGTC(4/5)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    PluTIGGCGC/CNot SensitiveNot SensitiveBlocked
    PmeIGTTT/AAACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    PmlICAC/GTGNot SensitiveNot SensitiveBlocked
    PpuMIRG/GWCCYNot SensitiveBlocked by OverlappingNot Sensitive
    PshAIGACNN/NNGTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    PsiITTA/TAANot SensitiveNot SensitiveNot Sensitive
    PspGI/CCWGGNot SensitiveBlockedNot Sensitive
    PspOMIG/GGCCCNot SensitiveImpaired by Some Combinations of OverlappingBlocked by Overlapping
    PspXIVC/TCGAGBNot SensitiveNot SensitiveImpaired
    PstICTGCA/GNot SensitiveNot SensitiveNot Sensitive
    PstI-HF®CTGCA/GNot SensitiveNot SensitiveNot Sensitive
    PvuICGAT/CGNot SensitiveNot SensitiveBlocked
    PvuI-HF®CGAT/CGNot SensitiveNot SensitiveBlocked
    PvuIICAG/CTGNot SensitiveNot SensitiveNot Sensitive
    PvuII-HF®CAG/CTGNot SensitiveNot SensitiveNot Sensitive
    EnzymeBack to topSequenceDamDcmCpG
    RsaIGT/ACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    RsrIICG/GWCCGNot SensitiveNot SensitiveBlocked
    EnzymeBack to topSequenceDamDcmCpG
    SacIGAGCT/CNot SensitiveNot SensitiveNot Sensitive
    SacI-HF®GAGCT/CNot SensitiveNot SensitiveNot Sensitive
    SacIICCGC/GGNot SensitiveNot SensitiveBlocked
    SalIG/TCGACNot SensitiveNot SensitiveBlocked
    SalI-HF®G/TCGACNot SensitiveNot SensitiveBlocked
    SalI-HF® RE-Mix®G/TCGACNot SensitiveNot SensitiveBlocked
    SapIGCTCTTC(1/4)Not SensitiveNot SensitiveNot Sensitive
    Sau3AI/GATCNot SensitiveNot SensitiveBlocked by Overlapping
    Sau96IG/GNCCNot SensitiveBlocked by OverlappingBlocked by Overlapping
    SbfICCTGCA/GGNot SensitiveNot SensitiveNot Sensitive
    SbfI-HF®CCTGCA/GGNot SensitiveNot SensitiveNot Sensitive
    ScaIAGT/ACTNot SensitiveNot SensitiveNot Sensitive
    ScaI-HF®AGT/ACTNot SensitiveNot SensitiveNot Sensitive
    ScaI-HF® RE-Mix®AGT/ACTNot SensitiveNot SensitiveNot Sensitive
    ScrFICC/NGGNot SensitiveBlocked by OverlappingBlocked by Overlapping
    SexAIA/CCWGGTNot SensitiveBlockedNot Sensitive
    SfaNIGCATC(5/9)Not SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
    SfcIC/TRYAGNot SensitiveNot SensitiveNot Sensitive
    SfiIGGCCNNNN/NGGCCNot SensitiveImpaired by Overlapping Blocked by Some Combinations of Overlapping
    SfoIGGC/GCCNot SensitiveBlocked by Some Combinations of OverlappingBlocked
    SgrAICR/CCGGYGNot SensitiveNot SensitiveBlocked
    SmaICCC/GGGNot SensitiveNot SensitiveBlocked
    SmlIC/TYRAGNot SensitiveNot SensitiveNot Sensitive
    SnaBITAC/GTANot SensitiveNot SensitiveBlocked
    SpeIA/CTAGTNot SensitiveNot SensitiveNot Sensitive
    SpeI RE-Mix®A/CTAGTNot SensitiveNot SensitiveNot Sensitive
    SpeI-HF®A/CTAGTNot SensitiveNot SensitiveNot Sensitive
    SphI-HF®GCATG/CNot SensitiveNot SensitiveNot Sensitive
    SphIGCATG/CNot SensitiveNot SensitiveNot Sensitive
    SspIAAT/ATTNot SensitiveNot SensitiveNot Sensitive
    SspI-HF®AAT/ATTNot SensitiveNot SensitiveNot Sensitive
    StuIAGG/CCTNot SensitiveBlocked by OverlappingNot Sensitive
    StyD4I/CCNGGNot SensitiveBlocked by OverlappingImpaired by Overlapping
    StyIC/CWWGGNot SensitiveNot SensitiveNot Sensitive
    StyI-HF®C/CWWGGNot SensitiveNot SensitiveNot Sensitive
    SwaIATTT/AAATNot SensitiveNot SensitiveNot Sensitive
    EnzymeBack to topSequenceDamDcmCpG
    TaqαIT/CGABlocked by OverlappingNot SensitiveNot Sensitive
    TfiIG/AWTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    TliIC/TCGAGNot SensitiveNot SensitiveImpaired
    TseIG/CWGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
    Tsp45I/GTSACNot SensitiveNot SensitiveNot Sensitive
    Tsp509I/AATTNot SensitiveNot SensitiveNot Sensitive
    TspMIC/CCGGGNot SensitiveNot SensitiveBlocked
    TspRINNCASTGNN/Not SensitiveNot SensitiveNot Sensitive
    Tth111IGACN/NNGTCNot SensitiveNot SensitiveNot Sensitive
    EnzymeBack to topSequenceDamDcmCpG
    XbaIT/CTAGABlocked by OverlappingNot SensitiveNot Sensitive
    XbaI RE-Mix®T/CTAGABlocked by OverlappingNot SensitiveNot Sensitive
    XcmICCANNNNN/NNNNTGGNot SensitiveNot SensitiveNot Sensitive
    XhoIC/TCGAGNot SensitiveNot SensitiveImpaired
    XhoI RE-Mix®C/TCGAGNot SensitiveNot SensitiveImpaired
    XmaIC/CCGGGNot SensitiveNot SensitiveImpaired
    XmnIGAANN/NNTTCNot SensitiveNot SensitiveNot Sensitive
    EnzymeBack to topSequenceDamDcmCpG
    ZraIGAC/GTCNot SensitiveNot SensitiveBlocked