Dam-Dcm and CpG Methylation

DNA methyltransferases (MTases) that transfer a methyl group from S-adenosylmethionine to either adenine or cytosine residues, are found in a wide variety of prokaryotes and eukaryotes. Methylation should be considered when digesting DNA with restriction endonucleases because cleavage can be blocked or impaired when a particular base in the recognition site is methylated.

Prokaryotic Methylation

In prokaryotes, MTases have most often been identified as elements of restriction/modification systems that act to protect host DNA from cleavage by the corresponding restriction endonuclease. Most laboratory strains of E. coli contain three site-specific DNA methylases.

  • Dam methylase–methylation at the N6 position of the adenine in the sequence GATC (1,2).
  • Dcm methyltransferases–methylation at the C5 position of the second cytosine in the sequences CCAGG and CCTGG (1,3).
  • EcoKI methylase–methylation of adenine in the sequences AAC(N6)GTGC and GCAC(N6)GTT.

Some or all of the sites for a restriction endonuclease may be resistant to cleavage when isolated from strains expressing the Dam or Dcm methylases if the methylase recognition site overlaps the endonuclease recognition site. For example, plasmid DNA isolated from dam+ E. coli is completely resistant to cleavage by MboI, which cleaves at GATC sites.

Not all DNA isolated from E. coli is methylated to the same extent. While pBR322 DNA is fully modified (and is therefore completely resistant to MboI digestion), only about 50% of λ DNA Dam sites are methylated, presumably because the methylase does not have the opportunity to methylate the DNA fully before it is packaged into the phage head. As a result, enzymes blocked by Dam or Dcm modification will yield partial digestion patterns with λ DNA.

Restriction sites that are blocked by Dam or Dcm methylation can be un-methylated by cloning your DNA into a dam, dcm strain of E. coli, such as dam/dcm Competent E. coli (NEB #C2925).

Restriction sites can also be blocked if an overlapping site is present. In this case, part of the Dam or Dcm sequence is generated by the restriction enzyme sequence, followed by the flanking sequence. This situation should also be considered when designing restriction enzyme digests.

Eukaryotic Methylation

CpG MTases, found in higher eukaryotes (e.g., Dnmt1), transfer a methyl group to the C5 position of cytosine residues. Patterns of CpG methylation are heritable, tissue specific and correlate with gene expression. Consequently, CpG methylation has been postulated to play a role in differentiation and gene expression (4).

Note: The effects of CpG methylation are mainly a concern when digesting eukaryotic genomic DNA. CpG methylation patterns are not retained once the DNA is cloned into a bacterial host.

Methylation Sensitivity

The table below summarizes methylation sensitivity for NEB restriction enzymes, indicating whether or not cleavage is blocked or impaired by Dam, Dcm or CpG methylation if or when it overlaps each recognition site. This table should be viewed as a guide to the behavior of the enzymes listed rather than an absolute indicator. Consult REBASE , the restriction enzyme database, for more detailed information and specific examples upon which these guidelines are based.

References

  1. Marinus, M.G. and Morris, N.R. (1973) J. Bacteriol. 114, 1143–1150. PMID: 4576399
  2. Geier, G.E.and Modrich, P. (1979) J. Biol. Chem. 254, 1408–1413. PMID: 368070
  3. May, M.S. and Hattman, S.(1975) J. Bacteriol. 123, 768–770. PMID: 1097428
  4. Siegfried, Z. and Cedar, H. (1997) Curr. Biol. 7, r305–307. PMID: 9115385

Legend

Not Sensitive   Impaired
Blocked Impaired by Overlapping
Blocked by Overlapping Impaired by Some Combinations of Overlapping
Blocked by Some Combinations of Overlapping
Single Letter Code
EnzymeSequenceDamDcmCpG
AatIIGACGT/CNot SensitiveNot SensitiveBlocked
AbaSINot SensitiveNot SensitiveNot Sensitive
Acc65IG/GTACCNot SensitiveBlocked by Some Combinations of OverlappingBlocked by Some Combinations of Overlapping
AccIGT/MKACNot SensitiveNot SensitiveBlocked by Overlapping
AciICCGC(-3/-1)Not SensitiveNot SensitiveBlocked
AclIAA/CGTTNot SensitiveNot SensitiveBlocked
AcuICTGAAG(16/14)Not SensitiveNot SensitiveNot Sensitive
AfeIAGC/GCTNot SensitiveNot SensitiveBlocked
AflIIC/TTAAGNot SensitiveNot SensitiveNot Sensitive
AflIIIA/CRYGTNot SensitiveNot SensitiveNot Sensitive
AgeI §A/CCGGTNot SensitiveNot SensitiveBlocked
AgeI-HF®A/CCGGTNot SensitiveNot SensitiveBlocked
AhdIGACNNN/NNGTCNot SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
AleICACNN/NNGTGNot SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
AluIAG/CTNot SensitiveNot SensitiveNot Sensitive
AlwIGGATC(4/5)BlockedNot SensitiveNot Sensitive
AlwNICAGNNN/CTGNot SensitiveBlocked by OverlappingNot Sensitive
ApaIGGGCC/CNot SensitiveBlocked by OverlappingBlocked by Overlapping
ApaLIG/TGCACNot SensitiveNot SensitiveBlocked by Overlapping
ApeKIG/CWGCNot SensitiveNot SensitiveBlocked by Overlapping
EnzymeSequenceDamDcmCpG
ApoI §R/AATTYNot SensitiveNot SensitiveNot Sensitive
ApoI-HFR/AATTYNot SensitiveNot SensitiveNot Sensitive
AscIGG/CGCGCCNot SensitiveNot SensitiveBlocked
AseIAT/TAATNot SensitiveNot SensitiveNot Sensitive
AsiSIGCGAT/CGCNot SensitiveNot SensitiveBlocked
AvaIC/YCGRGNot SensitiveNot SensitiveBlocked
AvaIIG/GWCCNot SensitiveBlocked by OverlappingBlocked by Overlapping
AvrIIC/CTAGGNot SensitiveNot SensitiveNot Sensitive
EnzymeBack to topSequenceDamDcmCpG
BaeGIGKGCM/CNot SensitiveNot SensitiveNot Sensitive
BaeI(10/15)ACNNNNGTAYC(12/7)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
BamHI §G/GATCCNot SensitiveNot SensitiveNot Sensitive
BamHI-HF®G/GATCCNot SensitiveNot SensitiveNot Sensitive
BanIG/GYRCCNot SensitiveBlocked by Some Combinations of OverlappingBlocked by Some Combinations of Overlapping
BanIIGRGCY/CNot SensitiveNot SensitiveNot Sensitive
BbsI §GAAGAC(2/6)Not SensitiveNot SensitiveNot Sensitive
BbsI-HF®GAAGAC(2/6)Not SensitiveNot SensitiveNot Sensitive
BbvCICCTCAGC(-5/-2)Not SensitiveNot SensitiveImpaired by Overlapping
BbvIGCAGC(8/12)Not SensitiveNot SensitiveNot Sensitive
BccICCATC(4/5)Not SensitiveNot SensitiveNot Sensitive
BceAIACGGC(12/14)Not SensitiveNot SensitiveBlocked
EnzymeSequenceDamDcmCpG
BcgI(10/12)CGANNNNNNTGC(12/10)Impaired by Overlapping Not SensitiveBlocked by Some Combinations of Overlapping
BciVIGTATCC(6/5)Not SensitiveNot SensitiveNot Sensitive
BclIT/GATCABlockedNot SensitiveNot Sensitive
BclI-HFT/GATCABlockedNot SensitiveNot Sensitive
BcoDIGTCTC(1/5)Not SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
BfaIC/TAGNot SensitiveNot SensitiveNot Sensitive
BfuAIACCTGC(4/8)Not SensitiveNot SensitiveImpaired by Overlapping
BfuCI/GATCNot SensitiveNot SensitiveBlocked by Overlapping
BglIGCCNNNN/NGGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
BglIIA/GATCTNot SensitiveNot SensitiveNot Sensitive
BlpIGC/TNAGCNot SensitiveNot SensitiveNot Sensitive
BmgBICACGTC(-3/-3)Not SensitiveNot SensitiveBlocked
BmrIACTGGG(5/4)Not SensitiveNot SensitiveNot Sensitive
BmtI §GCTAG/CNot SensitiveNot SensitiveNot Sensitive
BmtI-HF®GCTAG/CNot SensitiveNot SensitiveNot Sensitive
BpmICTGGAG(16/14)Not SensitiveNot SensitiveNot Sensitive
Bpu10ICCTNAGC(-5/-2)Not SensitiveNot SensitiveNot Sensitive
BpuEICTTGAG(16/14)Not SensitiveNot SensitiveNot Sensitive
BsaAIYAC/GTRNot SensitiveNot SensitiveBlocked
BsaBIGATNN/NNATCBlocked by OverlappingNot SensitiveBlocked by Some Combinations of Overlapping
EnzymeSequenceDamDcmCpG
BsaHIGR/CGYCNot SensitiveBlocked by Some Combinations of OverlappingBlocked
BsaI §GGTCTC(1/5)Not SensitiveImpaired by Some Combinations of OverlappingBlocked by Some Combinations of Overlapping
BsaI-HF®GGTCTC(1/5)Not SensitiveBlocked by OverlappingBlocked by Some Combinations of Overlapping
BsaJIC/CNNGGNot SensitiveNot SensitiveNot Sensitive
BsaWIW/CCGGWNot SensitiveNot SensitiveNot Sensitive
BsaXI(9/12)ACNNNNNCTCC(10/7)Not SensitiveNot SensitiveNot Sensitive
BseRIGAGGAG(10/8)Not SensitiveNot SensitiveNot Sensitive
BseYICCCAGC(-5/-1)Not SensitiveNot SensitiveBlocked by Overlapping
BsgIGTGCAG(16/14)Not SensitiveNot SensitiveNot Sensitive
BsiEICGRY/CGNot SensitiveNot SensitiveBlocked
BsiHKAIGWGCW/CNot SensitiveNot SensitiveNot Sensitive
BsiWI §C/GTACGNot SensitiveNot SensitiveBlocked
BsiWI-HF®C/GTACGNot SensitiveNot SensitiveBlocked
BslICCNNNNN/NNGGNot SensitiveBlocked by Some Combinations of OverlappingBlocked by Some Combinations of Overlapping
BsmAIGTCTC(1/5)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
BsmBICGTCTC(1/5)Not SensitiveNot SensitiveBlocked
BsmFIGGGAC(10/14)Not SensitiveBlocked by OverlappingBlocked by Overlapping
BsmIGAATGC(1/-1)Not SensitiveNot SensitiveNot Sensitive
BsoBIC/YCGRGNot SensitiveNot SensitiveNot Sensitive
Bsp1286IGDGCH/CNot SensitiveNot SensitiveNot Sensitive
EnzymeSequenceDamDcmCpG
BspCNICTCAG(9/7)Not SensitiveNot SensitiveNot Sensitive
BspDIAT/CGATBlocked by OverlappingNot SensitiveBlocked
BspEIT/CCGGABlocked by OverlappingNot SensitiveImpaired
BspHIT/CATGAImpaired by Overlapping Not SensitiveNot Sensitive
BspMIACCTGC(4/8)Not SensitiveNot SensitiveNot Sensitive
BspQIGCTCTTC(1/4)Not SensitiveNot SensitiveNot Sensitive
BsrBICCGCTC(-3/-3)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
BsrDIGCAATG(2/0)Not SensitiveNot SensitiveNot Sensitive
BsrFαIR/CCGGYNot SensitiveNot SensitiveBlocked
BsrFIR/CCGGYNot SensitiveNot SensitiveBlocked
BsrGI §T/GTACANot SensitiveNot SensitiveNot Sensitive
BsrGI-HF®T/GTACANot SensitiveNot SensitiveNot Sensitive
BsrIACTGG(1/-1)Not SensitiveNot SensitiveNot Sensitive
BssHIIG/CGCGCNot SensitiveNot SensitiveBlocked
BssKI/CCNGGNot SensitiveBlocked by OverlappingBlocked by Overlapping
BssSαICACGAG(-5/-1)Not SensitiveNot SensitiveNot Sensitive
BssSICACGAG(-5/-1)Not SensitiveNot SensitiveNot Sensitive
BstAPIGCANNNN/NTGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
BstBITT/CGAANot SensitiveNot SensitiveBlocked
BstEII  §G/GTNACCNot SensitiveNot SensitiveNot Sensitive
EnzymeSequenceDamDcmCpG
BstEII-HF®G/GTNACCNot SensitiveNot SensitiveNot Sensitive
BstNICC/WGGNot SensitiveNot SensitiveNot Sensitive
BstUICG/CGNot SensitiveNot SensitiveBlocked
BstXICCANNNNN/NTGGNot SensitiveBlocked by Some Combinations of OverlappingNot Sensitive
BstYIR/GATCYNot SensitiveNot SensitiveNot Sensitive
BstZ17I §GTA/TACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
BstZ17I-HF®GTATACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
Bsu36ICC/TNAGGNot SensitiveNot SensitiveNot Sensitive
BtgIC/CRYGGNot SensitiveNot SensitiveNot Sensitive
BtgZIGCGATG(10/14)Not SensitiveNot SensitiveImpaired
BtsαIGCAGTG(2/0)Not SensitiveNot SensitiveNot Sensitive
BtsCIGGATG(2/0)Not SensitiveNot SensitiveNot Sensitive
BtsIGCAGTG(2/0)Not SensitiveNot SensitiveNot Sensitive
BtsIMutICAGTG(2/0)Not SensitiveNot SensitiveNot Sensitive
EnzymeBack to topSequenceDamDcmCpG
Cac8IGCN/NGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
ClaIAT/CGATBlocked by OverlappingNot SensitiveBlocked
CspCI(11/13)CAANNNNNGTGG(12/10)Not SensitiveNot SensitiveNot Sensitive
CviAIIC/ATGNot SensitiveNot SensitiveNot Sensitive
CviKI-1RG/CYNot SensitiveNot SensitiveNot Sensitive
CviQIG/TACNot SensitiveNot SensitiveNot Sensitive
EnzymeBack to topSequenceDamDcmCpG
DdeIC/TNAGNot SensitiveNot SensitiveNot Sensitive
DpnIGA/TCNot SensitiveNot SensitiveBlocked by Overlapping
DpnII/GATCBlockedNot SensitiveNot Sensitive
DraITTT/AAANot SensitiveNot SensitiveNot Sensitive
DraIII §CACNNN/GTGNot SensitiveNot SensitiveImpaired by Overlapping
DraIII-HF®CACNNN/GTGNot SensitiveNot SensitiveImpaired by Overlapping
DrdIGACNNNN/NNGTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
EnzymeBack to topSequenceDamDcmCpG
EaeIY/GGCCRNot SensitiveBlocked by OverlappingBlocked by Overlapping
EagI §C/GGCCGNot SensitiveNot SensitiveBlocked
EagI-HF®C/GGCCGNot SensitiveNot SensitiveBlocked
EarICTCTTC(1/4)Not SensitiveNot SensitiveImpaired by Overlapping
EciIGGCGGA(11/9)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
Eco53kIGAG/CTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
EcoNICCTNN/NNNAGGNot SensitiveNot SensitiveNot Sensitive
EcoO109IRG/GNCCYNot SensitiveBlocked by OverlappingNot Sensitive
EcoP15ICAGCAG(25/27)Not SensitiveNot SensitiveNot Sensitive
EcoRI §G/AATTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
EcoRI-HF®G/AATTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
EcoRV §GAT/ATCNot SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
EcoRV-HF®GAT/ATCNot SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
EnzymeBack to topSequenceDamDcmCpG
FatI/CATGNot SensitiveNot SensitiveNot Sensitive
FauICCCGC(4/6)Not SensitiveNot SensitiveBlocked
Fnu4HIGC/NGCNot SensitiveNot SensitiveBlocked by Overlapping
FokIGGATG(9/13)Not SensitiveImpaired by Overlapping Impaired by Overlapping
FseIGGCCGG/CCNot SensitiveImpaired by Some Combinations of OverlappingBlocked
FspEICC(12/16)Not SensitiveNot SensitiveNot Sensitive
FspITGC/GCANot SensitiveNot SensitiveBlocked
EnzymeBack to topSequenceDamDcmCpG
HaeIIRGCGC/YNot SensitiveNot SensitiveBlocked
HaeIIIGG/CCNot SensitiveNot SensitiveNot Sensitive
HgaIGACGC(5/10)Not SensitiveNot SensitiveBlocked
HhaIGCG/CNot SensitiveNot SensitiveBlocked
HincIIGTY/RACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
HindIII §A/AGCTTNot SensitiveNot SensitiveNot Sensitive
HindIII-HF®A/AGCTTNot SensitiveNot SensitiveNot Sensitive
HinfIG/ANTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
HinP1IG/CGCNot SensitiveNot SensitiveBlocked
HpaIGTT/AACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
HpaIIC/CGGNot SensitiveNot SensitiveBlocked
HphIGGTGA(8/7)BlockedBlockedNot Sensitive
Hpy166IIGTN/NACNot SensitiveNot SensitiveBlocked by Overlapping
EnzymeSequenceDamDcmCpG
Hpy188ITCN/GABlocked by OverlappingNot SensitiveNot Sensitive
Hpy188IIITC/NNGABlocked by OverlappingNot SensitiveBlocked by Overlapping
Hpy99ICGWCG/Not SensitiveNot SensitiveBlocked
HpyAVCCTTC(6/5)Not SensitiveNot SensitiveImpaired by Overlapping
HpyCH4IIIACN/GTNot SensitiveNot SensitiveNot Sensitive
HpyCH4IVA/CGTNot SensitiveNot SensitiveBlocked
HpyCH4VTG/CANot SensitiveNot SensitiveNot Sensitive
EnzymeBack to topSequenceDamDcmCpG
I-CeuITAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceITAGGGATAACAGGGTAAT(-9/-13)
EnzymeBack to topSequenceDamDcmCpG
KasIG/GCGCCNot SensitiveNot SensitiveBlocked
KpnI §GGTAC/CNot SensitiveNot SensitiveNot Sensitive
KpnI-HF®GGTAC/CNot SensitiveNot SensitiveNot Sensitive
EnzymeBack to topSequenceDamDcmCpG
LpnPICCDG(10/14)Not SensitiveNot SensitiveNot Sensitive
EnzymeBack to topSequenceDamDcmCpG
MboI/GATCBlockedNot SensitiveImpaired by Overlapping
MboIIGAAGA(8/7)Blocked by OverlappingNot SensitiveNot Sensitive
MfeI §C/AATTGNot SensitiveNot SensitiveNot Sensitive
MfeI-HF®C/AATTGNot SensitiveNot SensitiveNot Sensitive
MluCI/AATTNot SensitiveNot SensitiveNot Sensitive
MluI §A/CGCGTNot SensitiveNot SensitiveBlocked
MluI-HF®A/CGCGTNot SensitiveNot SensitiveBlocked
EnzymeSequenceDamDcmCpG
MlyIGAGTC(5/5)Not SensitiveNot SensitiveNot Sensitive
MmeITCCRAC(20/18)Not SensitiveNot SensitiveBlocked by Overlapping
MnlICCTC(7/6)Not SensitiveNot SensitiveNot Sensitive
MscITGG/CCANot SensitiveBlocked by OverlappingNot Sensitive
MseIT/TAANot SensitiveNot SensitiveNot Sensitive
MslICAYNN/NNRTGNot SensitiveNot SensitiveNot Sensitive
MspA1ICMG/CKGNot SensitiveNot SensitiveBlocked by Overlapping
MspIC/CGGNot SensitiveNot SensitiveNot Sensitive
MspJICNNR(9/13)Not SensitiveNot SensitiveNot Sensitive
MwoIGCNNNNN/NNGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
EnzymeBack to topSequenceDamDcmCpG
NaeIGCC/GGCNot SensitiveNot SensitiveBlocked
NarIGG/CGCCNot SensitiveNot SensitiveBlocked
Nb.BbvCICCTCAGCNot SensitiveNot SensitiveNot Sensitive
Nb.BsmIGAATGCNot SensitiveNot SensitiveNot Sensitive
Nb.BsrDIGCAATGNot SensitiveNot SensitiveNot Sensitive
Nb.BssSICACGAGNot SensitiveNot SensitiveNot Sensitive
Nb.BtsIGCAGTGNot SensitiveNot SensitiveNot Sensitive
NciICC/SGGNot SensitiveNot SensitiveImpaired by Overlapping
NcoI §C/CATGGNot SensitiveNot SensitiveNot Sensitive
NcoI-HF®C/CATGGNot SensitiveNot SensitiveNot Sensitive
EnzymeSequenceDamDcmCpG
NdeICA/TATGNot SensitiveNot SensitiveNot Sensitive
NgoMIVG/CCGGCNot SensitiveNot SensitiveBlocked
NheI §G/CTAGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
NheI-HF®G/CTAGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
NlaIIICATG/Not SensitiveNot SensitiveNot Sensitive
NlaIVGGN/NCCNot SensitiveBlocked by OverlappingBlocked by Overlapping
NmeAIIIGCCGAG(21/19)Not SensitiveNot SensitiveNot Sensitive
NotI §GC/GGCCGCNot SensitiveNot SensitiveBlocked
NotI-HF®GC/GGCCGCNot SensitiveNot SensitiveBlocked
NruI §TCG/CGABlocked by OverlappingNot SensitiveBlocked
NruI-HF®TCG/CGABlocked by OverlappingNot SensitiveBlocked
NsiI §ATGCA/TNot SensitiveNot SensitiveNot Sensitive
NsiI-HF®ATGCA/TNot SensitiveNot SensitiveNot Sensitive
NspIRCATG/YNot SensitiveNot SensitiveNot Sensitive
Nt.AlwIGGATC(4/-5)BlockedNot SensitiveNot Sensitive
Nt.BbvCICCTCAGC(-5/-7)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
Nt.BsmAIGTCTC(1/-5)Not SensitiveNot SensitiveBlocked
Nt.BspQIGCTCTTC(1/-7)Not SensitiveNot SensitiveNot Sensitive
Nt.BstNBIGAGTC(4/-5)Not SensitiveNot SensitiveNot Sensitive
Nt.CviPII(0/-1)CCDNot SensitiveNot SensitiveBlocked
EnzymeBack to topSequenceDamDcmCpG
PacITTAAT/TAANot SensitiveNot SensitiveNot Sensitive
PaeR7IC/TCGAGNot SensitiveNot SensitiveBlocked
PciIA/CATGTNot SensitiveNot SensitiveNot Sensitive
PflFIGACN/NNGTCNot SensitiveNot SensitiveNot Sensitive
PflMICCANNNN/NTGGNot SensitiveBlocked by OverlappingNot Sensitive
PhoIGG/CCNot SensitiveImpaired by Some Combinations of OverlappingImpaired by Some Combinations of Overlapping
PI-PspITGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-SceIATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
PleIGAGTC(4/5)Not SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
PluTIGGCGC/CNot SensitiveNot SensitiveBlocked
PmeIGTTT/AAACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
PmlICAC/GTGNot SensitiveNot SensitiveBlocked
PpuMIRG/GWCCYNot SensitiveBlocked by OverlappingNot Sensitive
PshAIGACNN/NNGTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
PsiITTA/TAANot SensitiveNot SensitiveNot Sensitive
PspGI/CCWGGNot SensitiveBlockedNot Sensitive
PspOMIG/GGCCCNot SensitiveImpaired by Some Combinations of OverlappingBlocked by Overlapping
PspXIVC/TCGAGBNot SensitiveNot SensitiveImpaired
PstI §CTGCA/GNot SensitiveNot SensitiveNot Sensitive
PstI-HF®CTGCA/GNot SensitiveNot SensitiveNot Sensitive
EnzymeSequenceDamDcmCpG
PvuI §CGAT/CGNot SensitiveNot SensitiveBlocked
PvuI-HF®CGAT/CGNot SensitiveNot SensitiveBlocked
PvuII §CAG/CTGNot SensitiveNot SensitiveNot Sensitive
PvuII-HF®CAG/CTGNot SensitiveNot SensitiveNot Sensitive
EnzymeBack to topSequenceDamDcmCpG
RsaIGT/ACNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
RsrIICG/GWCCGNot SensitiveNot SensitiveBlocked
EnzymeBack to topSequenceDamDcmCpG
SacI §GAGCT/CNot SensitiveNot SensitiveNot Sensitive
SacI-HF®GAGCT/CNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
SacIICCGC/GGNot SensitiveNot SensitiveBlocked
SalI §G/TCGACNot SensitiveNot SensitiveBlocked
SalI-HF®G/TCGACNot SensitiveNot SensitiveBlocked
SapIGCTCTTC(1/4)Not SensitiveNot SensitiveNot Sensitive
Sau3AI/GATCNot SensitiveNot SensitiveBlocked by Overlapping
Sau96IG/GNCCNot SensitiveBlocked by OverlappingBlocked by Overlapping
SbfI §CCTGCA/GGNot SensitiveNot SensitiveNot Sensitive
SbfI-HF®CCTGCA/GGNot SensitiveNot SensitiveNot Sensitive
ScaI §AGT/ACTNot SensitiveNot SensitiveNot Sensitive
ScaI-HF®AGT/ACTNot SensitiveNot SensitiveNot Sensitive
ScrFICC/NGGNot SensitiveBlocked by OverlappingBlocked by Overlapping
SexAIA/CCWGGTNot SensitiveBlockedNot Sensitive
EnzymeSequenceDamDcmCpG
SfaNIGCATC(5/9)Not SensitiveNot SensitiveImpaired by Some Combinations of Overlapping
SfcIC/TRYAGNot SensitiveNot SensitiveNot Sensitive
SfiIGGCCNNNN/NGGCCNot SensitiveImpaired by Overlapping Blocked by Some Combinations of Overlapping
SfoIGGC/GCCNot SensitiveBlocked by Some Combinations of OverlappingBlocked
SgrAICR/CCGGYGNot SensitiveNot SensitiveBlocked
SmaICCC/GGGNot SensitiveNot SensitiveBlocked
SmlIC/TYRAGNot SensitiveNot SensitiveNot Sensitive
SnaBITAC/GTANot SensitiveNot SensitiveBlocked
SpeI §A/CTAGTNot SensitiveNot SensitiveNot Sensitive
SpeI-HF®A/CTAGTNot SensitiveNot SensitiveNot Sensitive
SphI §GCATG/CNot SensitiveNot SensitiveNot Sensitive
SphI-HF®GCATG/CNot SensitiveNot SensitiveNot Sensitive
SrfIGCCC/GGGCNot SensitiveNot SensitiveBlocked
SspI §AAT/ATTNot SensitiveNot SensitiveNot Sensitive
SspI-HF®AAT/ATTNot SensitiveNot SensitiveNot Sensitive
StuIAGG/CCTNot SensitiveBlocked by OverlappingNot Sensitive
StyD4I/CCNGGNot SensitiveBlocked by OverlappingImpaired by Overlapping
StyI §C/CWWGGNot SensitiveNot SensitiveNot Sensitive
StyI-HF®C/CWWGGNot SensitiveNot SensitiveNot Sensitive
SwaIATTT/AAATNot SensitiveNot SensitiveNot Sensitive
EnzymeBack to topSequenceDamDcmCpG
TaqαIT/CGABlocked by OverlappingNot SensitiveNot Sensitive
TfiIG/AWTCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
TliIC/TCGAGNot SensitiveNot SensitiveImpaired
TseIG/CWGCNot SensitiveNot SensitiveBlocked by Some Combinations of Overlapping
Tsp45I/GTSACNot SensitiveNot SensitiveNot Sensitive
Tsp509I/AATTNot SensitiveNot SensitiveNot Sensitive
TspMIC/CCGGGNot SensitiveNot SensitiveBlocked
TspRINNCASTGNN/Not SensitiveNot SensitiveNot Sensitive
Tth111IGACN/NNGTCNot SensitiveNot SensitiveNot Sensitive
EnzymeBack to topSequenceDamDcmCpG
XbaIT/CTAGABlocked by OverlappingNot SensitiveNot Sensitive
XcmICCANNNNN/NNNNTGGNot SensitiveNot SensitiveNot Sensitive
XhoIC/TCGAGNot SensitiveNot SensitiveImpaired
XmaIC/CCGGGNot SensitiveNot SensitiveImpaired
XmnIGAANN/NNTTCNot SensitiveNot SensitiveNot Sensitive
EnzymeBack to topSequenceDamDcmCpG
ZraIGAC/GTCNot SensitiveNot SensitiveBlocked