Alphabetized List of Recognition Specificities

  • My NEB
  • Print
  • PDF
  • All restriction endonuclease recognition specificities available from New England Biolabs are listed below. For enzymes that recognize non-palindromic sequences, the complementary sequence of each strand is listed. For example, CCTC(7/6) and (6/7)GAGG both represent an MnlI (NEB #R0163) site.

    All recognition sequences are written 5´ to 3´ using the single letter code nomenclature with the point of cleavage indicated by a "/".

    Numbers in parentheses indicate point of cleaveage for non-palindromic enzymes.

    For example, GGTCTC(1/5) indicates cleavage at:
    5´ ...GGTCTCN/...3´
    3´ ...CCAGAGNNNNN/...5´

    Recognition SequenceEnzyme
    AA/CGTTAclI
    A/AGCTTHindIII HindIII-HF®
    AAT/ATTSspI SspI-HF®
    /AATTMluCI Tsp509I
    A/CATGTPciI
    A/CCGGTAgeI AgeI-HF AgeI-HF® RE-Mix®
    ACCTGC(4/8)BspMI BfuAI
    A/CCWGGTSexAI
    A/CGCGTMluI
    ACGGC(12/14)BceAI
    A/CGTHpyCH4IV
    ACN/GTHpyCH4III
    (10/15)ACNNNNGTAYC(12/7)BaeI
    (9/12)ACNNNNNCTCC(10/7)BsaXI
    A/CRYGTAflIII
    A/CTAGTSpeI SpeI-HF® SpeI RE-Mix®
    ACTGG(1/-1)BsrI
    ACTGGG(5/4)BmrI
    A/GATCTBglII
    AGC/GCTAfeI
    AG/CTAluI
    AGG/CCTStuI
    AGT/ACTScaI ScaI-HF® ScaI-HF® RE-Mix®
    AT/CGATClaI BspDI
    ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)PI-SceI
    ATGCA/TNsiI
    AT/TAATAseI
    ATTT/AAATSwaI
    (11/13)CAANNNNNGTGG(12/10)CspCI
    C/AATTGMfeI MfeI-HF® MfeI-HF® RE-Mix®
    CACGAG(-5/-1)BssSI
    CACGTC(-3/-3)BmgBI
    CAC/GTGPmlI
    CACNCACDvuIII
    CACNNN/GTGDraIII DraIII-HF®
    CACNN/NNGTGAleI
    CAGCAG(25/27)EcoP15I
    CAG/CTGPvuII PvuII-HF®
    CAGNNN/CTGAlwNI
    CAGTG(2/0)BtsIMutI
    NNCASTGNN/TspRI
    CA/TATGNdeI
    CATG/NlaIII
    C/ATGCviAII
    /CATGFatI
    CAYNN/NNRTGMslI
    CC(12/16)FspEI
    CCANNNNN/NNNNTGGXcmI
    CCANNNNN/NTGGBstXI
    CCANNNN/NTGGPflMI
    CCATC(4/5)BccI
    C/CATGGNcoI NcoI-HF® NcoI-HF® RE-Mix®
    CCCAGC(-5/-1)BseYI
    CCCGC(4/6)FauI
    CCC/GGGSmaI
    C/CCGGGXmaI TspMI
    (0/-1)CCDNt.CviPII
    CCDG(10/14)LpnPI
    CCGC(-3/-1)AciI
    CCGC/GGSacII
    CCGCTC(-3/-3)BsrBI
    C/CGGMspI HpaII
    CC/NGGScrFI
    /CCNGGBssKI StyD4I
    C/CNNGGBsaJI
    CCNNNNN/NNGGBslI
    C/CRYGGBtgI
    CC/SGGNciI
    C/CTAGGAvrII
    CCTC(7/6)MnlI
    CCTCAGC(-5/-2)BbvCI
    CCTCAGCNb.BbvCI
    CCTCAGC(-5/-7)Nt.BbvCI
    CCTGCA/GGSbfI SbfI-HF®
    CCTNAGC(-5/-2)Bpu10I
    CC/TNAGGBsu36I
    CCTNN/NNNAGGEcoNI
    CCTTC(6/5)HpyAV
    CC/WGGBstNI
    /CCWGGPspGI
    C/CWWGGStyI StyI-HF®
    (10/12)CGANNNNNNTGC(12/10)BcgI
    CGAT/CGPvuI PvuI-HF®
    CG/CGBstUI
    C/GGCCGEagI EagI-HF®
    CG/GWCCGRsrII
    CGRY/CGBsiEI
    C/GTACGBsiWI
    CGTCTC(1/5)BsmBI
    CGWCG/Hpy99I
    CMG/CKGMspA1I
    CNNR(9/13)MspJI
    CR/CCGGYGSgrAI
    C/TAGBfaI
    CTCAG(9/7)BspCNI
    C/TCGAGXhoI PaeR7I TliI XhoI RE-Mix®
    CTCTTC(1/4)EarI
    CTGAAG(16/14)AcuI
    CTGCA/GPstI PstI-HF®
    CTGGAG(16/14)BpmI
    C/TNAGDdeI
    C/TRYAGSfcI
    C/TTAAGAflII
    CTTGAG(16/14)BpuEI
    C/TYRAGSmlI
    C/YCGRGAvaI BsoBI
    GAAGA(8/7)MboII
    GAAGAC(2/6)BbsI
    GAANN/NNTTCXmnI
    GAATGC(1/-1)BsmI
    GAATGCNb.BsmI
    G/AATTCEcoRI EcoRI-HF® EcoRI-HF® RE-Mix®
    GACGC(5/10)HgaI
    GACGT/CAatII
    GAC/GTCZraI
    GACN/NNGTCTth111I PflFI
    GACNN/NNGTCPshAI
    GACNNN/NNGTCAhdI
    GACNNNN/NNGTCDrdI
    GAG/CTCEco53kI
    GAGCT/CSacI SacI-HF®
    GAGGAG(10/8)BseRI
    GAGTC(4/5)PleI
    GAGTC(4/-5)Nt.BstNBI
    GAGTC(5/5)MlyI
    G/ANTCHinfI
    GAT/ATCEcoRV EcoRV-HF® EcoRV-HF® RE-Mix®
    /GATCMboI Sau3AI DpnII BfuCI
    GA/TCDpnI
    GATNN/NNATCBsaBI
    G/AWTCTfiI
    GCAATG(2/0)BsrDI
    GCAATGNb.BsrDI
    GCAGC(8/12)BbvI
    GCAGTG(2/0)BtsI
    GCAGTGNb.BtsI
    GCANNNN/NTGCBstAPI
    GCATC(5/9)SfaNI
    GCATG/CSphI SphI-HF®
    GCCGAG(21/19)NmeAIII
    GCC/GGCNaeI
    G/CCGGCNgoMIV
    GCCNNNN/NGGCBglI
    GCGAT/CGCAsiSI
    GCGATG(10/14)BtgZI
    G/CGCHinP1I
    GCG/CHhaI
    G/CGCGCBssHII
    GC/GGCCGCNotI NotI-HF® NotI-HF® RE-Mix® 
    GC/NGCFnu4HI
    GCN/NGCCac8I
    GCNNNNN/NNGCMwoI
    G/CTAGCNheI NheI-HF® NheI-HF® RE-Mix®
    GCTAG/CBmtI BmtI-HF®
    GCTCTTC(1/4)SapI BspQI
    GCTCTTC(1/-7)Nt.BspQI
    GC/TNAGCBlpI
    G/CWGCTseI ApeKI
    GDGCH/CBsp1286I
    GGATC(4/5)AlwI
    GGATC(4/-5)Nt.AlwI
    G/GATCCBamHI BamHI-HF®
    GGATG(9/13)FokI
    GGATG(2/0)BtsCI
    GG/CCHaeIII PhoI
    GGCCGG/CCFseI
    GGCCNNNN/NGGCCSfiI
    GG/CGCCNarI
    G/GCGCCKasI
    GGC/GCCSfoI
    GGCGC/CPluTI
    GG/CGCGCCAscI AscI RE-Mix®
    GGCGGA(11/9)EciI
    GGGAC(10/14)BsmFI
    GGGCC/CApaI
    G/GGCCCPspOMI
    G/GNCCSau96I
    GGN/NCCNlaIV
    GGTAC/CKpnI KpnI-HF® KpnI-HF® RE-Mix®
    G/GTACCAcc65I
    GGTCTC(1/5)BsaI BsaI-HF®
    GGTGA(8/7)HphI
    G/GTNACCBstEII  BstEII-HF® BstEII-HF® RE-Mix®
    G/GWCCAvaII
    G/GYRCCBanI
    GKGCM/CBaeGI
    GR/CGYCBsaHI
    GRGCY/CBanII
    GT/ACRsaI
    G/TACCviQI
    GTA/TACBstZ17I
    GTATCC(6/5)BciVI
    G/TCGACSalI SalI-HF® SalI-HF® RE-Mix®
    GTCTC(1/-5)Nt.BsmAI
    GTCTC(1/5)BsmAI BcoDI
    G/TGCACApaLI
    GTGCAG(16/14)BsgI
    GT/MKACAccI
    GTN/NACHpy166II
    /GTSACTsp45I
    GTT/AACHpaI
    GTTT/AAACPmeI
    GTY/RACHincII
    GWGCW/CBsiHKAI
    R/AATTYApoI
    RCATG/YNspI
    R/CCGGYBsrFI
    R/GATCYBstYI
    RGCGC/YHaeII
    RG/CYCviKI-1
    RG/GNCCYEcoO109I
    RG/GWCCYPpuMI
    TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)I-CeuI
    TAC/GTASnaBI
    TAGGGATAACAGGGTAAT(-9/-13)I-SceI
    T/CATGABspHI
    T/CCGGABspEI
    TCCRAC(20/18)MmeI
    T/CGATaqαI
    TCG/CGANruI
    TCN/GAHpy188I
    TC/NNGAHpy188III
    T/CTAGAXbaI XbaI RE-Mix®
    T/GATCABclI
    TG/CAHpyCH4V
    TGC/GCAFspI
    TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)PI-PspI
    TGG/CCAMscI
    T/GTACABsrGI
    T/TAAMseI
    TTAAT/TAAPacI PacI RE-Mix®
    TTA/TAAPsiI
    TT/CGAABstBI
    TTT/AAADraI
    VC/TCGAGBPspXI
    W/CCGGWBsaWI
    YAC/GTRBsaAI
    Y/GGCCREaeI