• My NEB
  • Print
  • PDF
  • pGLuc Mini-TK 2 Vector

    Description

    pGLuc Mini-TK 2 is a cloning vector for mammalian cells, containing a minimal promoter fragment from the HSV thymidine kinase (TK) promoter adjacent to a reporter gene, the secreted luciferase from the copepod Gaussia princepsGaussia Luciferase (GLuc) is a 19 kDa protein encoded by a "humanized" sequence, and it contains a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells into the cell culture medium (1,2). The pGLuc Mini-TK 2 Vector contains a multiple cloning site (MCS) upstream of the minimal TK promoter for cloning promoter or enhancer elements. A neomycin resistance gene under the control of the SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418.

    N8086
    Figure 1:  A genomic DNA fragment containing putative estrogen response elements was inserted into the polylinker of pGLuc Mini-TK 2 Vector. The properties of this fragment were assessed in a transfection assay. GLuc activity was measured in the culture supernatant of MCF-7 cells transfected with the construct
    and treated with vehicle control (C) or estradiol (E2).


    Figure 2:
    The pGLuc Mini-TK 2 Vector MCS. The TATA box is underlined and the first amino acids of GLuc are indicated above the DNA sequence.

    DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.

    Highlights

    • Polylinker MCS: 12–68
    • Minimal promoter from Herpes simplex virus Thymidine Kinase (Mini-TK): 69–131
    • GLuc coding: 146–703
    • Start codon: 146–148
    • Stop codon: 701–703 • Signal peptide: 146–196 • Synthetic poly-A site: 712–760
    • Neo promoter (SV40): 1346-1681
    • Neomycin resistance gene: 1733-2527
    • Bacterial replication ori (pMB1): 3861-3273
    • Amp resistance: 4892-4032
    • All pGLuc-2 vectors have improved polyadenylation- transcription termination of the luciferase transcript. The polyadenylation signal is a synthetic polyadenylation sequence based on the b-globin gene (5).

    Product Source

    Isolated from E. coli strain NEB 10-beta by a standard DNA purification procedure.

    Advantages and Features

    Features

    • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
    • 90–95% of GLuc activity is found in the cell culture medium, with the remaining 5–10% detectable in cell lysates. This allows flexibility when assaying GLuc along with other co-transfected reporters.
    • The activity of GLuc is high and the GLuc assay is sensitive enough to detect very small amounts of GLuc enzyme activity.
    • GLuc is very stable in the cell culture medium so the GLuc activity detected reflects the amount of GLuc secreted by the transfected cells over a period of several days. GLuc can also be stored at 4°C for several days without any loss in activity.
    • GLuc does not use the same substrate as Cypridina Luciferase. Therefore, it is possible to assay both GLuc and CLuc independently in cell culture medium from cells expressing both reporters (3,4).
    • The pGLuc Mini-TK 2 Vector can be transfected into cells using any standard transfection protocol and stable cell lines can be established using Neomycin selection.
    Recommended Sequencing Primers for pGLuc Mini-TK 2 Vector (not available from NEB)
    Upstream of MCS (23-mer):
    GGGGTTCCGCGCACATTTCCCCG (4987–5009)

    pBasic Reverse Primer (25-mer)
    TCAGAAGCCATAGAGCCCACCGCAT (855–831)

    GLuc 3´ end Forward Primer (20-mer)
    GCCAGCAAGATCCAGGGCCA (650–669)

    GLuc 5´ End Reverse Primer (24-mer)
    TCAGGGCAAACAGAACTTTGACTC (173–150)

    Applications

    • The pGLuc Mini-TK 2 Vector can be used to test promoter or enhancer elements by cloning into the MCS upstream of the minimal TK promoter. For constitutive expression of GLuc, vectors containing promoters are available (see Companion Products Sold Separately).
    • GLuc can be used as a stand alone reporter or in conjunction with other compatible reporters such as Cypridina Luciferase (CLuc) (3). GLuc and CLuc are ideally suited for co-expression as both are secreted and highly active enzymes providing ease of use and sensitivity (3,4).

    Properties and Usage

    Storage Temperature

    -20°C

    Storage Conditions

    10 mM Tris-HCl
    1 mM EDTA
    pH 7.5 @ 25°C

    Sequence Files

    Fasta  GenBank  

    References

    1. Verhaegan, M. and Christopoulos, T.K. (2002). Anal. Chem.. 74, 4378-4385.
    2. Tannous, B.A. et al. (2005). Mol. Ther.. 11, 435-443.
    3. Otsuji, et al. (2004). Anal. Biochemistry. 329, 230-237.
    4. Wu, et al. (2007). Biotechniques. 42, 290-292.
    5. Levitt, et al. (1989). Genes Dev.. 3, 1019-1025.

    FAQs

    1. Where can I find the sequence of this plasmid?
    2. Can I generate a stable cell line with pGLuc Mini-TK 2 Vector?
    3. Can I transfect this plasmid into mammalian cells?
    4. How do I assay for GLuc expression?
    5. Is there another secreted reporter that can be used with GLuc?

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.

    Selection Tools

    Interactive Tools

    Safety Data Sheet

    The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.