• My NEB
  • Print
  • PDF
  • pTK-GLuc Vector

    Description

    The pTK-GLuc Vector is a mammalian expression vector that encodes the secreted luciferase from the copepod Gaussia princeps as a reporter, under the control of the constitutive Herpes Simplex Virus thymidine kinase promoter. Gaussia Luciferase (GLuc) is a 20 kDa protein encoded by a "humanized" sequence, and it contains a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells into the cell culture medium (1,2). pTK-GLuc has a multiple cloning site (MCS) between the GLuc stop codon and the polyadenylation site. A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418.
    N8084
    N8084
    Figure 1:  pTK-GLuc multiple cloning site (MCS). The Gaussia Luciferase sequence is shown with a blue background. Only unique restriction sites are shown.

    DNASU is a central repository for plasmid clones and collections that may also be helpful.

    Highlights

    • TK promoter: 18–771
    • GLuc coding: 802–1359
    • Start codon: 802–804
    • Stop codon: 1357–1359
    • Signal peptide: 802–852
    • Multiple cloning site (MCS) downstream of GLuc: 1360–1391 (NotI, AgeI, XhoI, XbaI)
    • SV40 late polyadenylation signal: 1392–1622
    • Neo promoter (SV40): 2215–2550
    • Neomycin resistance gene 2602–3396
    • NeoR poly-A(SV40 early): 3570–3700
    • Bacterial replication ori (pMB1) 4730–4142
    • Amp resistance 5761–4901

    Product Source

    Isolated from E. coli strain NEB10β by a standard DNA purification procedure.

    Advantages and Features

    Features

    • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
    • 90–95% of GLuc activity is found in the cell culture medium, with the remaining 5–10% detectable in cell lysates. This allows flexibility when assaying GLuc along with other cotransfected reporters.
    • The activity of GLuc is high and the GLuc assay is sensitive enough to detect very small amounts of GLuc enzyme activity.
    • GLuc is very stable in the cell culture medium so the GLuc activity detected reflects the amount of GLuc secreted by the transfected cells over a period of several days. GLuc can also be stored at 4°C for several days without any loss in activity.
    • GLuc does not use the same substrate as Cypridina Luciferase. Therefore, it is possible to assay both GLuc and CLuc independently in cell culture medium from cells expressing both reporters (3,4).
    • The pTK-GLuc Vector can be transfected into cells using any standard transfection protocol and stable cell lines can be established using Neomycin (G418) selection.
    Recommended Sequencing Primers for pTK-GLuc Vector (not available from NEB)
    pBasic Reverse Primer (25-mer)
    TCAGAAGCCATAGAGCCCACCGCAT (1724–1690)

    GLuc 3´ end Forward Primer (20-mer)
    GCCAGCAAGATCCAGGGCCA (1310–1325)

    GLuc 5´ End Reverse Primer (24-mer)
    TCAGGGCAAACAGAACTTTGACTC (829–806)

    Applications

    • The pTK-GLuc Vector can be used as a control for assessing the efficiency of transfection in mammalian cells. Plasmids containing other constitutive promoter elements are also available (see Companion products Sold Separately).
    • pTK-GLuc Vector has a multiple cloning site (MCS) between the GLuc stop codon and the polyadenylation signal. This allows the cloning of sequences that will be part of the GLuc mRNA, such as 3´ UTR sequences, that can be used for RNA stability, RNAi or miRNA target evaluation.
    • GLuc can be used as a stand alone reporter or in conjunction with other compatible reporters such as Cypridina Luciferase (CLuc) (3). GLuc and CLuc are ideally suited for co-expression as both are secreted and highly active enzymes providing ease of use and sensitivity (3,4).

    Properties and Usage

    Storage Temperature

    -20°C

    Storage Conditions

    10 mM Tris-HCl
    1 mM EDTA
    pH 7.5 @ 25°C

    References

    1. Verhaegen, M. and Christopoulos, T.K. (2002). Anal. Chem. 74, 4378-4385.
    2. Tannous, B.A. et al. (2005). Mol. Ther. 11, 435–443.
    3. Otsuji, et al. (2004). Anal. Biochemistry. 329, 230-237.
    4. Wu, et al. (2007). Biotechniques. 42, 290-292.

    Supporting Documents

    Material Safety Datasheets

    The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.
    1. Where can I find the sequence of this plasmid?
    2. Can I generate a stable cell line with pTK-GLuc Vector?
    3. Can I transfect this plasmid into mammalian cells?
    4. How do I assay for GLuc expression?
    5. Is there another secreted reporter that can be used with GLuc?

    Selection Tools

    Interactive Tools