• My NEB
  • Print
  • PDF
  • pCMV-GLuc 2 Control Plasmid

    Description

    The pCMV-GLuc 2 Control Plasmid is a mammalian expression vector that encodes the secreted luciferase from the copepod Gaussia princeps as a reporter, under the control of the constitutive CMV (cytomegalovirus) promoter. Gaussia luciferase (GLuc) is a 19 kDa protein encoded by a "humanized" sequence, and it contains a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells into the cell culture medium (1,2). A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418.

    Comparison of light output obtained from secreted GLuc versus Renilla luciferase in U2OS cells that were transiently transfected with the corresponding expression vectors. Supernatants (GLuc) and lysates (Renilla) were harvested at 24 hour post-transfection and assayed for luciferase activity using the BioLux GLuc Assay System.

    DNASU is a central repository for plasmid clones and collections that may also be helpful.

    Highlights

    • CMV promoter: 209–863
    • GLuc coding: 920–1477
    • Start codon: 920–922
    • Stop codon: 1475–1477
    • Signal peptide: 920–970
    • Synthetic poly-A site: 1486–1534
    • Neo promoter (SV40): 2120–2455
    • Neomycin resistance gene: 2507–3301
    • Bacterial replication ori (pMB1): 4635–4047
    • Amp resistance: 5666–4806
    • All pGLuc-2 vectors have improved polyadenylation-transcription termination of the luciferase transcript. The polyadenylation signal is a synthetic polyadenylation sequence based on the β-globin gene (5).

    Product Source

    Isolated from E. coli strain NEB10β by a standard DNA purification procedure.

    N8081_updtSNAP

    Advantages and Features

    Features

    • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
    • 90–95% of GLuc activity is found in the cell culture medium, with the remaining 5–10% detectable in cell lysates. This allows flexibility when assaying GLuc along with other co-transfected reporters.
    • The activity of GLuc is high and the GLuc assay is sensitive enough to detect very small amounts of GLuc enzyme activity.
    • GLuc is very stable in the cell culture medium so the GLuc activity detected reflects the amount of GLuc secreted by the transfected cells over a period of several days. GLuc can also be stored at 4°C for several days without any loss in activity.
    • GLuc does not use the same substrate as Cypridina luciferase. Therefore, it is possible to assay both GLuc and CLuc independently in cell culture medium from cells expressing both reporters (3,4).
    • The pCMV-GLuc 2 Control Plasmid can be transfected into cells using any standard transfection and stable cell lines can be established using Neomycin selection.
    Recommended Sequencing Primers for pCMV-GLuc 2 Control Plasmid (not available from NEB)
    T7 Universal Primer (20-mer)
    TAATACGACTCACTATAGGG (863–882)

    pBasic Reverse Primer (25-mer)
    TCAGAAGCCATAGAGCCCACCGCAT (1629–1605)

    GLuc 3´ End Forward Primer (20-mer)
    GCCAGCAAGATCCAGGGCCA (1424–1443)

    GLuc 5´ End Reverse Primer (24-mer)
    TCAGGGCAAACAGAACTTTGACTC (947–924)

    Applications

    • The pCMV-GLuc 2 Control Plasmid can be used as a control for assessing the efficiency of transfection in mammalian cells. Plasmids containing other constitutive promoter elements are also available (see Companion Products Sold Separately).
    • GLuc can be used as a stand alone reporter or in conjunction with other compatible reporters such as Cypridina luciferase (CLuc) (3). GLuc and CLuc are ideally suited for co-expression as both are secreted and highly active enzymes providing ease of use and sensitivity (3,4).

    Properties and Usage

    Storage Temperature

    -20°C

    Storage Conditions

    10 mM Tris-HCl
    1 mM EDTA
    pH 7.5 @ 25°C

    References

    1. Verhaegen, M. and Christopoulos, T.K. (2002). Anal. Chem. 74, 4378-4385.
    2. Tannous, B.A. et al. (2005). Mol. Ther. 11, 435-443.
    3. Otsuji, et al. (2004). Anal. Biochemistry. 329, 230-237.
    4. Wu, et al. (2007). Biotechniques. 42, 290-292.
    5. Levitt, et al. (1989). Genes Dev. 3, 1019-1025.

    Supporting Documents

    Material Safety Datasheets

    The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.
    1. Where can I find the sequence of this plasmid?
    2. Can I generate a stable cell line with pCMV-GLuc 2 Control Plasmid?
    3. Can I transfect this plasmid into mammalian cells?
    4. How do I assay for GLuc expression?
    5. Is there another secreted reporter that can be used with CLuc?

    Selection Tools

    Interactive Tools

    Application Notes