Fluorescein-siRNA Transfection Control

  • This product was discontinued on January 01, 2013
$name

Ordering Information

N2100
  • Discontinued
    Discontinued
  • Product Information
    The fluorescein labeled siRNA is used as a control for RNA transfections. The chemically synthesized 21 base RNA has two complementary strands each with a fluorescein linked to the 5´ end base. It has a 19 bp dsRNA region with 2 base 3´ extensions.The sequence of Fluorescein-siRNA Transfection control has no sequence identity to any mammalian sequences in the database.

    The sequences of the two complementary strands are given below:

    Fluorescein-5´AGGUCGAACUACGGGUCAAUC3´
    MW: 7272.6 g/ml

    Fluorescein-5´UUGACCCGUAGUUCGACCUAG3´
    MW: 7186.5 g/ml

    The Fluorescein-siRNA can be used to estimate the transfection efficiency of siRNA with a particular cell line. It facilitates parameter optimization such as cell density, amount of transfection reagent, etc.

    Figure 1:
    HCT 116 cells transfected with Fluorescein siRNA Transfection Control using TransPass R1 Transfection Reagent (NEB #M2551).
    Product Categories:
    Discontinued Products
    • Properties and Usage
    • Notes
  • Protocols & Manuals
  • Other Tools & Resources
  • Quality & Safety
  • Legal Information
    • Legal And Disclaimers
Loading Spinner