• My NEB
  • Print
  • PDF
  • Fluorescein-siRNA Transfection Control

    Discontinued Date

    01/01/2013
    Catalog #SizeConcentrationPriceQtyAdd to Cart
      
    Categories:
    Discontinued Products

    Description

    The fluorescein labeled siRNA is used as a control for RNA transfections. The chemically synthesized 21 base RNA has two complementary strands each with a fluorescein linked to the 5´ end base. It has a 19 bp dsRNA region with 2 base 3´ extensions.The sequence of Fluorescein-siRNA Transfection control has no sequence identity to any mammalian sequences in the database.

    The sequences of the two complementary strands are given below:

    Fluorescein-5´AGGUCGAACUACGGGUCAAUC3´
    MW: 7272.6 g/ml

    Fluorescein-5´UUGACCCGUAGUUCGACCUAG3´
    MW: 7186.5 g/ml

    The Fluorescein-siRNA can be used to estimate the transfection efficiency of siRNA with a particular cell line. It facilitates parameter optimization such as cell density, amount of transfection reagent, etc.

    Figure 1:
    HCT 116 cells transfected with Fluorescein siRNA Transfection Control using TransPass R1 Transfection Reagent (NEB #M2551).

    Properties and Usage

    Storage Temperature

    -20°C

    Quality Control

    Quality Assurance Statement

    • Purified by gel electrophoresis.

    Notes

    1. It is important to maintain healthy cells. Some cell lines become more sensitive to transfection agents after a large number of passages. It is advisable to use cells subjected to a similar number of passages to ensure reproducible transfection results in different experiments.
    2. It is recommended that control transfections be performed by varying cell confluence and using different amounts of TransPass Transfection Reagent. In general, low cell density or too much transfection reagent increase the risk of cell toxicity. The medium may be replaced 24 hours after transfection with fresh complete medium to increase cell viability. 
      In order to easily estimate the efficiency of transfection of particular cell lines use the Fluorescein-siRNA Transfection Control (NEB #N2100S).
    3. Transfection of siRNA Mixtures:  The transfection of siRNA must be optimal in order to obtain maximum silencing of a target gene. Optimizing the following parameters may be necessary in order to maximize the transfection efficiency for a particular cell line: the cell density at the time of transfection, the amount of transfection reagent, the amount of siRNA and the culture incubation time before analysis.

    Supporting Documents

    Material Safety Datasheets

    The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.
    1. ShortCut® siRNA Mix Suggested Protocol