pCLuc Mini-TK 2 Vector

This product has been discontinued on 1/1/17 and replaced by N0317.

  • This product was discontinued on January 01, 2017

Ordering Information

N0324
  • Discontinued
    Discontinued
  • Product Information

    pCLuc Mini-TK 2 is a cloning vector for mammalian cells, containing a minimal promoter fragment from the HSV thymidine kinase (TK) promoter adjacent to a reporter gene, the secreted luciferase from the Ostracod Cypridina noctiluca. Cypridina luciferase (CLuc) is a 62 kDa protein with a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells (1) so that CLuc activity can be detected in the culture medium of mammalian cells expressing the reporter gene. The pCLuc Mini-TK 2 Vector contains a MCS upstream of the minimal TK promoter for cloning promoter or enhancer elements. A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418.

    Recommended sequencing primers for pCLuc Mini-TK 2 Vector (not available from NEB)

    Upstream of MCS:
    pBasic Forward Primer (23-mer)
    GGGGTTCCGCGCACATTTCCCCG (6090–6112)

    pBasic Reverse Primer (25-mer)
    TCAGAAGCCATAGAGCCCACCGCAT (1958–1934)

    CLuc 3´ end Forward Primer (23-mer)
    GAGTTCAAGAAAGAATGCTACAT (1741–1763)

    CLuc 5´ End Reverse Primer (24-mer)
    GTAAGGACAGTCCTGGCAATGAAC (213–190)


    Figure 1: Cypridina Luciferase (CLuc) activity obtained from different CLuc plasmidsFigure 1
    HeLa cell supernatants (20 μl) and lysates (5 μl) were assayed with the BioLux CLuc Assay Kit (NEB #E3309). HeLa cells were seeded in 12-well plates and transfected with 50 ng of CLuc-expressing plasmid per well. At 24 hr post-transfection, supernatants were collected and cell lysed in 100 μl per well using Luciferase Cell Lysis Buffer (NEB #B3321). The CLuc activity was measured in a Mithras LB940 (Berthold Technologies) luminometer set to: 50 μl of injection, 2 seconds of delay and 2 seconds of integration.
    Figure 2: pCLuc Mini-TK 2 Vector multiple cloning site (MCS) Figure 2: pCLuc Mini-TK 2 Vector multiple cloning site (MCS)
    Figure 2: pCLuc Mini-TK 2 Vector multiple cloning site (MCS)
    The mini-TK promoter element and the beginning of the CLuc sequence are highlighted.

    DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.

    Highlights

    • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
    • 90–95% of CLuc activity is found in the cell culture medium, with the remaining 5-10% detectable in cell lysates (Figure 1). This allows flexibility when assaying CLuc along with other co-transfected reporters.
    • The activity of CLuc is high and the CLuc assay is sensitive enough to detect very small amounts of CLuc enzyme activity (Figure 2).
    • CLuc does not use the same substrate as other marine luciferases (e.g. Renilla, Gaussia). Therefore, it is possible to assay both CLuc and GLuc independently in cell culture medium from cells expressing both reporters.
    • The pCLuc Mini-TK 2 Vector can be transfected into cells using any standard transfection protocol.

    Product Source

    Isolated from E. coli strain ER2272 by a standard DNA purification procedure.
    Product Categories:
    Cypridina Luciferase Products,
    DNA Plasmid & Substrates Products
    Applications:
    Gaussia Luciferase,
    Yeast Protein Expression,
    Protein Labeling
    ,
    Proteomics
    • Advantages and Features
    • Properties and Usage
    • Related Products
    • Notes
    • References
  • FAQs & Tech Tips
  • Protocols & Manuals
    • Datacards
  • Other Tools & Resources
  • Quality & Safety
  • Legal Information
    • Legal And Disclaimers
Loading Spinner