pCLuc Mini-TK 2 is a cloning vector for
mammalian cells, containing a minimal promoter
fragment from the HSV thymidine kinase (TK)
promoter adjacent to a reporter gene, the secreted
luciferase from the Ostracod Cypridina noctiluca.
Cypridina luciferase (CLuc) is a 62 kDa protein
with a native signal peptide at the N-terminus that
allows it to be secreted from mammalian cells (1)
so that CLuc activity can be detected in the culture
medium of mammalian cells expressing the reporter
gene. The pCLuc Mini-TK 2 Vector contains a MCS
upstream of the minimal TK promoter for cloning
promoter or enhancer elements. A neomycin resistance
gene under the control of an SV40 promoter
allows selection for stable integration of the plasmid
into the mammalian cell genome using G418.
Recommended sequencing primers for pCLuc Mini-TK 2 Vector (not available from NEB)
Upstream of MCS:
pBasic Forward Primer (23-mer)
GGGGTTCCGCGCACATTTCCCCG (6090–6112)
pBasic Reverse Primer (25-mer)
TCAGAAGCCATAGAGCCCACCGCAT (1958–1934)
CLuc 3´ end Forward Primer (23-mer)
GAGTTCAAGAAAGAATGCTACAT (1741–1763)
CLuc 5´ End Reverse Primer (24-mer)
GTAAGGACAGTCCTGGCAATGAAC (213–190)
Figure 1:
Cypridina Luciferase (CLuc) activity obtained from different CLuc plasmidsHeLa cell supernatants (20 μl) and lysates (5 μl) were assayed with
the BioLux CLuc Assay Kit (NEB #E3309). HeLa cells were seeded in 12-well
plates and transfected with 50 ng of CLuc-expressing plasmid per well. At
24 hr post-transfection, supernatants were collected and cell lysed in 100 μl
per well using Luciferase Cell Lysis Buffer (NEB #B3321). The CLuc activity
was measured in a Mithras LB940 (Berthold Technologies) luminometer set
to: 50 μl of injection, 2 seconds of delay and 2 seconds of integration.Figure 2: pCLuc Mini-TK 2 Vector multiple cloning site (MCS) The mini-TK promoter element and the beginning of the CLuc sequence are highlighted.
DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.
Highlights
Multiple samples can be obtained from the same
transfected cells (i.e., before and after experimental
treatments or at multiple time points).
90–95% of CLuc activity is found in the cell
culture medium, with the remaining 5-10%
detectable in cell lysates (Figure 1). This allows
flexibility when assaying CLuc along with other
co-transfected reporters.
The activity of CLuc is high and the CLuc assay is
sensitive enough to detect very small amounts of
CLuc enzyme activity (Figure 2).
CLuc does not use the same substrate as other
marine luciferases (e.g. Renilla, Gaussia). Therefore,
it is possible to assay both CLuc and GLuc
independently in cell culture medium from cells
expressing both reporters.
The pCLuc Mini-TK 2 Vector can be transfected into cells using any standard transfection protocol.
Product Source
Isolated from E. coli strain ER2272 by a standard DNA purification procedure.
Minimal promoter from HSV-Thymidine Kinase (MiniTK): 69–137
Kozak Consensus: 139–148
CLuc ORF: 145–1806
Start codon of CLuc 145–147
Stop codon: 1804–1806
Signal peptide: 145–198
Synthetic poly-A site: 1815–1863
SV40 promoter (NeoR): 2449–2784
NeoR Orf: 2836–3630
SV40 early polyadenylation signal: 3804–3934
Ori: pMB1 origin of replication (complement):4376–4964
AmpR (beta-lactamase complement): 5135–5995
Two restriction sites are available for cloning elements downstream of the CLuc coding region. The NotI site is upstream of the polyA site and allows cloning of sequences which will become part of the CLuc mRNA. The XbaI site is downstream of the polyA site, sequences cloned into the XbaI site will not be incorporated into CLuc mRNA.
All pLuc-2 vectors have improved poly-adenylationtranscription termination of the luciferase transcript. The polyadenylation signal is a synthetic polyadenylation sequence based on the b-globin gene (5).
Application Features
The pCLuc Mini-TK 2 Vector can be used to test promoter or enhancer elements by cloning into the MCS upstream of the minimal TK promoter. For constitutive expression of CLuc, vectors containing constitutive promoter elements are available (see Related Products).
The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.)
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.
The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.)
This product is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB).
While NEB develops and validates its products for various applications, the use of this product may require the buyer to obtain additional third party intellectual property rights for certain applications.
For more information about commercial rights, please contact NEB's Global Business Development team at gbd@neb.com.
This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.
Licenses
Licensed under certain patents and patent applications from the National Institute of Advanced Industrial Science and Technology ("AIST") for Research and Development Purposes.
For use of the Biolux Cypridina Luciferase Assay Kit, or associated assay reagents, in human diagnosis and measurement in relation to human health, contact busdev@neb.com.
Based on your Freezer Program type, you are trying to add a product to your cart that is either not allowed or not allowed with the existing contents of your cart. Please review and update your order accordingly If you have any questions, please contact Customer Service at freezers@neb.com or 1-800-632-5227 x 8.
You have been idle for more than 20 minutes, for your security you have been logged out. Please sign back in to continue your session.
Institution Changed
Your profile has been mapped to an Institution, please sign back for your profile updates to be completed.
Sign in to your NEB account
To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.
