• My NEB
  • Print
  • PDF
    •

    pCLuc Mini-TK 2 Vector

    Description

    pCLuc Mini-TK 2 is a cloning vector for mammalian cells, containing a minimal promoter fragment from the HSV thymidine kinase (TK) promoter adjacent to a reporter gene, the secreted luciferase from the Ostracod Cypridina noctiluca. Cypridina luciferase (CLuc) is a 62 kDa protein with a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells (1) so that CLuc activity can be detected in the culture medium of mammalian cells expressing the reporter gene. The pCLuc Mini-TK 2 Vector contains a MCS upstream of the minimal TK promoter for cloning promoter or enhancer elements. A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418.

    Recommended sequencing primers for pCLuc Mini-TK 2 Vector (not available from NEB)

    Upstream of MCS:
    pBasic Forward Primer (23-mer)
    GGGGTTCCGCGCACATTTCCCCG (6090–6112)

    pBasic Reverse Primer (25-mer)
    TCAGAAGCCATAGAGCCCACCGCAT (1958–1934)

    CLuc 3´ end Forward Primer (23-mer)
    GAGTTCAAGAAAGAATGCTACAT (1741–1763)

    CLuc 5´ End Reverse Primer (24-mer)
    GTAAGGACAGTCCTGGCAATGAAC (213–190)


    Figure 1: Activity of CLuc in supernatants and lysates from a stable CLuc-expressing cell line. CLuc activity was measured from 20 µl of cell culture supernatant (500 µl total culture volume) and from 20 µl of cell lysate (100 µl total lysate volume).
    Figure 2: The high sensitivity of both the CLuc and GLuc assays allows detection of very small numbers of cells expressing each protein. 20 µl of culture supernatant from the indicated number of cells expressing each reporter were assayed.
    N0319
    Figure 3: pCLuc Mini-TK 2 Vector multiple cloning site (MCS). The mini-TK promoter element and the beginning of the CLuc sequence are highlighted.

    DNASU is a central repository for plasmid clones and collections that may also be helpful.

    Highlights

    • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
    • 90–95% of CLuc activity is found in the cell culture medium, with the remaining 5-10% detectable in cell lysates (Figure 1). This allows flexibility when assaying CLuc along with other co-transfected reporters.
    • The activity of CLuc is high and the CLuc assay is sensitive enough to detect very small amounts of CLuc enzyme activity (Figure 2).
    • CLuc does not use the same substrate as other marine luciferases (e.g. Renilla, Gaussia). Therefore, it is possible to assay both CLuc and GLuc independently in cell culture medium from cells expressing both reporters.
    • The pCLuc Mini-TK 2 Vector can be transfected into cells using any standard transfection protocol.

    Product Source

    Isolated from E. coli strain ER2272 by a standard DNA purification procedure.

    Advantages and Features

    Features

    • Polylinker upstream of Mini-TK: 20–68
    • Minimal promoter from HSV-Thymidine Kinase (MiniTK): 69–137
    • Kozak Consensus: 139–148
    • CLuc ORF: 145–1806
    • Start codon of CLuc 145–147
    • Stop codon: 1804–1806
    • Signal peptide: 145–198
    • Synthetic poly-A site: 1815–1863
    • SV40 promoter (NeoR): 2449–2784
    • NeoR Orf: 2836–3630
    • SV40 early polyadenylation signal: 3804–3934
    • Ori: pMB1 origin of replication (complement):4376–4964
    • AmpR (beta-lactamase complement): 5135–5995
    • Two restriction sites are available for cloning elements downstream of the CLuc coding region. The NotI site is upstream of the polyA site and allows cloning of sequences which will become part of the CLuc mRNA. The XbaI site is downstream of the polyA site, sequences cloned into the XbaI site will not be incorporated into CLuc mRNA.
    • All pLuc-2 vectors have improved poly-adenylationtranscription termination of the luciferase transcript. The polyadenylation signal is a synthetic polyadenylation sequence based on the b-globin gene (5).

    Applications

    The pCLuc Mini-TK 2 Vector can be used to test promoter or enhancer elements by cloning into the MCS upstream of the minimal TK promoter. For constitutive expression of CLuc, vectors containing constitutive promoter elements are available (see Related Products).

    Properties and Usage

    Storage Temperature

    -20°C

    Storage Conditions

    10 mM Tris-HCl
    1 mM EDTA
    pH 7.5 @ 25°C

    Sequence Files

    Fasta  GenBank  

    References

    1. Nakajima, et al. (2004). Biosci. Biotechnol. Biochem. 68, 565-570.
    2. Otsuji, et al. (2004). Anal. Biochemistry. 329, 230-237.
    3. Wu, et al. (2007). Biotechniques. 42, 290-292.
    4. Levitt, et al. (1989). Genes Dev.. 3, 1019-1025.

    FAQs

    1. Where can I find the sequence of this plasmid?
    2. Can I transfect this plasmid into mammalian cells?
    3. How do I assay for CLuc expression?
    4. Can I use assay kits designed for other reporters (Gaussia, Renilla & Firefly luciferases) to assay CLuc activity?
    5. Is there another secreted reporter that can be used with CLuc?
    6. Can I make a stable cell line with pCLuc Mini-TK 2 Vector?

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.

    Selection Tools

    Interactive Tools

    Material Safety Datasheets

    The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.