pTK-CLuc Vector

This product has been discontinued on 1/1/17 and replaced by N0317.

  • This product was discontinued on January 01, 2017

Ordering Information

N0322
  • Discontinued
    Discontinued
  • Product Information
    The pTK-CLuc Vector is a mammalian expression vector that encodes the secreted luciferase from the Ostracod Cypridina noctiluca as a reporter, under the control of the constitutive HSV thymidine kinase promoter. Cypridina luciferase (CLuc) is a 62 kDa protein with a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells (1,2). Because it is secreted CLuc can be detected in the culture medium of mammalian cells expressing the reporter gene. pTK-CLuc has a multiple cloning site (MCS) between the CLuc stop codon and the polyadenylation site. pTK-CLuc contains a selectable marker that is suited for creating stable integrants in the mammalian cell genome.

    Recommended sequencing primers for pTK-CLuc Vector (not available from NEB)

    pBasic Reverse Primer (25-mer)
    TCAGAAGCCATAGAGCCCACCGCAT (2827-2803)

    CLuc 3´ end Forward Primer (23-mer)
    GAGTTCAAGAAAGAATGCTACAT (2397-2419)

    CLuc 5´ End Reverse Primer (24-mer)
    GTAAGGACAGTCCTGGCAATGAAC (869-846)

    Figure 1: Cypridina Luciferase (CLuc) activity obtained from different CLuc plasmidsFigure 1: Cypridina Luciferase (CLuc) activity obtained from different CLuc plasmids
    HeLa cell supernatants (20 μl) and lysates (5 μl) were assayed with the BioLux CLuc Assay Kit (NEB #E3309). HeLa cells were seeded in 12-well plates and transfected with 50 ng of CLuc-expressing plasmid per well. At 24 hr post-transfection, supernatants were collected and cell lysed in 100 μl per well using Luciferase Cell Lysis Buffer (NEB #B3321). The CLuc activity was measured in a Mithras LB940 (Berthold Technologies) luminometer set to: 50 μl of injection, 2 seconds of delay and 2 seconds of integration.
    Figure 2: pTK-CLuc multiple cloning site (MCS)Figure 2: pTK-CLuc multiple cloning site (MCS

    DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.

    Highlights

    • TK promoter (BglII-HindIII): 18-776
    • Start codon of CLuc: 801-803
    • Stop codon: 2460-2462
    • CLuc coding: 801-2462
    • Signal peptide: 801-854
    • Polylinker downstream of CLuc 2463-2489 NotI, AgeI, XhoI, XbaI
    • Poly-A site (from SV40): 2490-2733
    • NeoR promoter (SV40): 3318-3653
    • NeoR: 3705-4499
    • NeoR poly-A(SV40): 4673-4803
    • Bacterial replication ori (pMB1) 5833-5245
    • Amp Resistance gene 6864-6004
    Product Categories:
    Cypridina Luciferase Products,
    DNA Plasmid & Substrates Products
    Applications:
    Cypridina Luciferase,
    Yeast Protein Expression,
    Protein Labeling
    ,
    Proteomics
    • Advantages and Features
    • Properties and Usage
    • Related Products
    • Notes
    • References
  • FAQs & Tech Tips
  • Protocols & Manuals
    • Datacards
  • Other Tools & Resources
  • Quality & Safety
  • Legal Information
    • Legal And Disclaimers
Loading Spinner