• My NEB
  • Print
  • PDF
  • pTK-CLuc Vector

    Description

    The pTK-CLuc Vector is a mammalian expression vector that encodes the secreted luciferase from the Ostracod Cypridina noctiluca as a reporter, under the control of the constitutive HSV thymidine kinase promoter. Cypridina luciferase (CLuc) is a 62 kDa protein with a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells (1,2). Because it is secreted CLuc can be detected in the culture medium of mammalian cells expressing the reporter gene. pTK-CLuc has a multiple cloning site (MCS) between the CLuc stop codon and the polyadenylation site. pTK-CLuc contains a selectable marker that is suited for creating stable integrants in the mammalian cell genome.

    Recommended sequencing primers for pTK-CLuc Vector (not available from NEB)

    pBasic Reverse Primer (25-mer)
    TCAGAAGCCATAGAGCCCACCGCAT (2827-2803)

    CLuc 3´ end Forward Primer (23-mer)
    GAGTTCAAGAAAGAATGCTACAT (2397-2419)

    CLuc 5´ End Reverse Primer (24-mer)
    GTAAGGACAGTCCTGGCAATGAAC (869-846)

    Figure 1: Activity of Cypridina Luciferase in supernatants and lysates from a stable CLuc-expressing cell line. CLuc activity was measured from 20 µl of cell culture supernatant (500 µl total culture volume) and from 20 µl of cell lysate (100 µl total lysate volume).
    Figure 2: The high sensitivity of both the CLuc and GLuc assays allows detection of very small numbers of cells expressing each protein. 20 µl of culture supernatant from the indicated number of cells expressing each reporter were assayed.

    Figure 3: pTK-CLuc multiple cloning site (MCS).

    DNASU is a central repository for plasmid clones and collections that may also be helpful.

    Highlights

    • TK promoter (BglII-HindIII): 18-776
    • Start codon of CLuc: 801-803
    • Stop codon: 2460-2462
    • CLuc coding: 801-2462
    • Signal peptide: 801-854
    • Polylinker downstream of CLuc 2463-2489 NotI, AgeI, XhoI, XbaI
    • Poly-A site (from SV40): 2490-2733
    • NeoR promoter (SV40): 3318-3653
    • NeoR: 3705-4499
    • NeoR poly-A(SV40): 4673-4803
    • Bacterial replication ori (pMB1) 5833-5245
    • Amp Resistance gene 6864-6004

    Advantages and Features

    Features

    • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
    • 90–95% of CLuc activity is found in the cell culture medium, with the remaining 5-10% detectable in cell lysates (Figure 1). This allows flexibility when assaying CLuc along with other co-transfected reporters.
    • The activity of CLuc is high and the CLuc assay is sensitive enough to detect very small amounts of CLuc enzyme activity (Figure 2).
    • CLuc does not use the same substrate as other marine luciferases (e.g. Renilla, Gaussia). Therefore, it is possible to assay both CLuc and GLuc independently in cell culture medium from cells expressing both reporters (3).
    • The pTK-CLuc Vector can be transfected into cells using any standard transfection protocol.

    Applications

    • The pTK-CLuc Vector can be used as a control for assessing the efficiency of transfection in mammalian cells. pTK-CLuc Vector has a multiple cloning site (MCS) between the CLuc stop codon and the polyadenylation signal. This allows the cloning of sequences that will be part of the CLuc mRNA, such as 3´ UTR sequences, that can be used for RNA stability or RNAi or miRNA target evaluation. 
    • Plasmids containing other constitutive promoter elements are also available (see Related Products).

    Properties and Usage

    Storage Temperature

    -20°C

    References

    1. Nakajima, et al. (2004). Biosci. Biotechnol. Biochem. 68, 565-570.
    2. Otsuji, et al. (2004). 329, 230-237.
    3. Wu, et al. (2007). Biotechniques. 42, 290-292.

    Supporting Documents

    Material Safety Datasheets

    The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.
    1. Where can I find the sequence of this plasmid?
    2. Can I make a stable cell line with pTK-CLuc Vector?
    3. Can I transfect this plasmid into mammalian cells?
    4. How do I assay for CLuc expression?
    5. Can I use assay kits designed for other reporters (Gaussia, Renilla & Firefly luciferases) to assay CLuc activity?
    6. Is there another secreted reporter that can be used with CLuc?

    Selection Tools

    Interactive Tools