pCMV-CLuc 2 Control Plasmid

The pCMV-CLuc 2 Control Plasmid is a mammalian expression plasmid that constitutively expresses the secreted luciferase from the Ostrapod Cypridina noctiluca (CLuc) under the control of the CMV promoter.

  • CLuc can be assayed in the culture medium of mammalian cells expressing Cypridina
  • CLuc does not use the same substrate as other marine luciferases, e.g., Renilla and Gaussia.  Therefore, it is possible to assay both CLuc and GLuc independently in cell culture medium from cells expressing both reporters.
  • Can be used to generate Neomycin-resistant stable cell lines

Ordering Information

$name
  • 500 μg/ml
    20 μg
    $289.00
  • Product Information
    The pCMV-CLuc Control Plasmid is a mammalian expression vector that encodes the secreted luciferase from the Ostracod Cypridina noctiluca as a reporter, under the control of the constitutive CMV (cytomegalovirus) promoter. Cypridina luciferase (CLuc) is a 62 kDa protein with a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells (1). Because it is secreted CLuc can be detected in the culture medium of mammalian cells expressing the reporter gene. A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418. 

    Recommended sequencing primers for pCMV-CLuc 2 Control Plasmid (not available from NEB)

    T7 Universal Primer (20-mer)
    TAATACGACTCACTATAGGG (863-882)

    pBasic Reverse Primer (25-mer)
    TCAGAAGCCATAGAGCCCACCGCAT (2732-2708)

    CLuc 3´ End Forward Primer (23-mer)
    GAGTTCAAGAAAGAATGCTACAT (2515-2537)

    CLuc 5´ End Reverse Primer (24-mer)
    GTAAGGACAGTCCTGGCAATGAAC (987-964)
    Figure 1: Activity of Cypridina Luciferase in supernatants and lysates from a stable CLuc-expressing cell line  Figure 1: Activity of Cypridina Luciferase in supernatants and lysates from a stable CLuc-expressing cell line
    CLuc activity was measured from 20 µl of cell culture supernatant (500 µl total culture volume) and from 20 µl of cell lysate (100 µl total lysate volume).
    Figure 2: Figure 2
    The high sensitivity of both the CLuc and GLuc assays allows detection of very small numbers of cells expressing each protein. 20 µl of culture supernatant from the indicated number of cells expressing each reporter were assayed.

    DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.

    Highlights

    • CMV promoter: 209-863 
    • CLuc coding: 919-2580
    • Start codon: 919-921
    • Stop codon: 2578-2580
    • Signal peptide: 919-972
    • Synthetic poly-A site: 2589-2637
    • Neo promoter (SV 40): 3223-3558
    • Neomycin resistance gene: 3623-4404
    • Bacterial replication ori (pMB1): 5738- 
    • Amp resistance: 6769-5909
    • All pLuc-2 vectors have improved polyadenylation-transcription termination of the luciferase transcript. The polyadenylation signal is a synthetic polyadenylation sequence based on the β-globin gene (4).
    N0321c
    Product Categories:
    Cypridina Luciferase Products,
    DNA Plasmid Products
    Applications:
    Cypridina Luciferase,
    Yeast Protein Expression,
    Protein Labeling
    ,
    Proteomics
  • FAQs & Tech Tips
  • Protocols & Manuals
  • Other Tools & Resources
  • Quality & Safety
  • Legal Information
    • Legal And Disclaimers
Loading Spinner