• My NEB
  • Print
  • PDF
  • pCMV-CLuc 2 Control Plasmid

    Description

    The pCMV-CLuc Control Plasmid is a mammalian expression vector that encodes the secreted luciferase from the Ostracod Cypridina noctiluca as a reporter, under the control of the constitutive CMV (cytomegalovirus) promoter. Cypridina luciferase (CLuc) is a 62 kDa protein with a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells (1). Because it is secreted CLuc can be detected in the culture medium of mammalian cells expressing the reporter gene. A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418. 

    Recommended sequencing primers for pCMV-CLuc 2 Control Plasmid (not available from NEB)

    T7 Universal Primer (20-mer)
    TAATACGACTCACTATAGGG (863-882)

    pBasic Reverse Primer (25-mer)
    TCAGAAGCCATAGAGCCCACCGCAT (2732-2708)

    CLuc 3´ End Forward Primer (23-mer)
    GAGTTCAAGAAAGAATGCTACAT (2515-2537)

    CLuc 5´ End Reverse Primer (24-mer)
    GTAAGGACAGTCCTGGCAATGAAC (987-964)
    Figure 1: Activity of Cypridina Luciferase in supernatants and lysates from a stable CLuc-expressing cell line. CLuc activity was measured from 20 µl of cell culture supernatant (500 µl total culture volume) and from 20 µl of cell lysate (100 µl total lysate volume).
    Figure 2: The high sensitivity of both the CLuc and GLuc assays allows detection of very small numbers of cells expressing each protein. 20 µl of culture supernatant from the indicated number of cells expressing each reporter were assayed.

    DNASU is a central repository for plasmid clones and collections that may also be helpful.

    Highlights

    • CMV promoter: 209-863 
    • CLuc coding: 919-2580
    • Start codon: 919-921
    • Stop codon: 2578-2580
    • Signal peptide: 919-972
    • Synthetic poly-A site: 2589-2637
    • Neo promoter (SV 40): 3223-3558
    • Neomycin resistance gene: 3623-4404
    • Bacterial replication ori (pMB1): 5738- 
    • Amp resistance: 6769-5909
    • All pLuc-2 vectors have improved polyadenylation-transcription termination of the luciferase transcript. The polyadenylation signal is a synthetic polyadenylation sequence based on the β-globin gene (4).


    N0321c

    Advantages and Features

    Features

    • The pCMV-CLuc 2 Control Plasmid can be used as a control for assessing the efficiency of transfection in mammalian cells. Plasmids containing other constitutive promoter elements are also available (see Companion Products Sold Separately).

    Applications

    • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
    • CLuc does not use the same substrate as other marine luciferases (e.g. Renilla, Gaussia). Therefore, it is possible to assay both CLuc and GLuc independently in cell culture medium from cells expressing both reporters (3).
    • The pCMV-CLuc 2 Control Plasmid can be transfected into cells using any standard transfection protocol.

    Properties and Usage

    Storage Temperature

    -20°C

    References

    1. Nakajima, et al. Biosci. Biotechnol. Biochem. 68, 565-570.
    2. Otsuji, et al. (2004). Anal. Biochemistry. 329, 230-237.
    3. Wu, et al. (2007). Biotechniques. 42, 290-292.
    4. Levitt, et al. (1989). Genes Dev. 3, 1019-1025.

    Supporting Documents

    Material Safety Datasheets

    The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

    Datacards

    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.
    1. Where can I find the sequence of this plasmid?
    2. Can I make a stable cell line with pCMV-CLuc 2 Control Plasmid?
    3. How do I assay for CLuc expression?
    4. Can I use assay kits designed for other reporters (Gaussia, Renilla & Firefly luciferases) to assay CLuc activity?
    5. Is there another secreted reporter that can be used with CLuc?

    Selection Tools

    Interactive Tools