• My NEB
  • Print
  • PDF
  • K. lactis YCT284 Competent Cells

    • This product was discontinued on 01/05/2015
    Catalog #SizeConcentrationPriceQtyAdd to Cart
    Discontinued Products


    Chemically competent Kluyveromyces lactis YCT284 (∆cts1) cells are a preferred host for secreting heterologous proteins carrying a chitin binding domain tag. YCT284 cells can be transformed with any linearized pKLAC-series expression vector. K. lactis strain YCT284 carries a selectable marker-free deletion of the KLLA0C04730g locus encoding an extracellular chitinase (KlCts1p) which can degrade chitin chromatography resin and compete for resin binding sites (1). 

    Reagents Supplied

    The following reagents are supplied with this product:

    Store at (°C)Concentration
    NEB Yeast Transformation Reagent (5 ml)41X

    Properties and Usage

    Storage Temperature



    1. Due to the high transformation efficiency of K. lactis YCT284 (∆cts1) Competent Cells, plating multiple dilutions of the cell mixture is necessary to ensure formation of plates with distinct single colonies. Growth time should not exceed 5 days as small colonies that lack an integrated expression fragment may form.

      Plates containing colonies can be stored at 4°C for up to two weeks.

      K. lactis YCT284 (∆cts1) Competent Cells may form small clumps when grown in liquid culture (1). This can obscure cell density measurements using light scattering techniques.

      The deletion of locus KLLA0C04730g in YCT284 can be confirmed by PCR using the primers GGTCACCAGAAATACAAG and ATAAAAATATGATAAGGCTACACG to amplify a 2.0 kb diagnostic fragment.

      The chitin binding domain (KlChBD) derived from the K. lactis secreted Cts1p chitinase (1) is not suitable for cytoplasmic expression and purification of KIChBD-tagged proteins.
    2. Store Competent Cells at -80°C. Once Thawed, Do Not Re-freeze.


    1. Colussi, P.A. et al. (2005). Appl. Environ. Microbiol. 71, 2862-2869.

    Tech Tips

    Always store immediately at -80 C.  Yeast competent cells will quickly lose competency if handled improperly.


    1. Transformation K. lactis YCT284 Competent Cells (C1002)


    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.

    Interactive Tools

    Application Notes

    Quality Control

    Quality Control Assays

    The following Quality Control Tests are performed on each new lot and meet the specifications designated for the product. Individual lot data can be found on the Product Summary Sheet/Datacard or Manual which can be found in the Supporting Documents section of this page.
    • Sterility (K. lactis) :
      The product is tested for bacterial and/or fungal contamination by a plating assay.
    • Transformation Efficiency:
      The competent cells are tested for transformation efficiency and pass minimum release criteria. Transformation efficiency is defined as the number of colony forming units (cfu) which would be produced by transforming 1 μg of plasmid into a given volume of competent cells.

    Safety Data Sheet

    The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.


    The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.