pUC19 Vector

Description

pUC19 is a commonly used plasmid cloning vector in E.coli. The molecule is a small double-stranded circle, 2686 base pairs in length, and has a high copy number. pUC19 carries a 54 base-pair multiple cloning site polylinker that contains unique sites for 13 different hexanucleotide-specific restriction endonucleases (1).


DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.

Product Source

pUC19 is isolated from E. coli ER2272 (dam+ dcm+ EcoK M-) by a standard plasmid purification procedure.

Polylinker DNA Sequence

GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT 

GENBANK Assession Number

L09137

Properties and Usage

General Utility

Cloning

Copy Number

High (100+)

Origin of Replication

  • pMB1 (high-copy mutant)

Storage Temperature

-20°C

Storage Conditions

10 mM Tris-HCl
1 mM EDTA
pH 8.0 @ 25°C

References

  1. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). Gene. 33, 103-119.

FAQs

  1. How homogeneous is the DNA/ how much is supercoiled?
  2. Are the plasmids cesium purified?

Datacards

The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.

Interactive Tools

Certificate of Analysis

The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality control's for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

Specifications

The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

Safety Data Sheet

The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

Datacards

The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.