• My NEB
  • Print
  • PDF
  • EpiMark® 5-hmC and 5-mC Analysis Kit

    Description

    5-methylcytosine (5-mC) is the predominant epigenetic mark in mammalian genomic DNA. 5-hydroxymethylcytosine (5-hmC) is a newly discovered epigenetic modification that is presumably generated by oxidation of 5-mC by the TET family of cytosine oxygenases(1)().

    Techniques exist that can identify 5-mC in genomic DNA, but the most commonly used method, bisulfite sequencing, is laborious and cannot distinguish between 5-mC from 5-hmC(2).

    The EpiMark® 5-hmC and 5-mC Analysis Kit can be used to analyze and quantitate 5-methylcytosine and 5-hydroxymethylcytosine within a specific locus. The kit distinguishes 5-mC from 5-hmC by the addition of glucose to the hydroxyl group of 5-hmC via an enzymatic reaction utilizing T4 β-glucosyltransferase (T4-BGT). When 5-hmC occurs in the context of CCGG, this modification converts a cleavable MspI site to a noncleavable one.

    The EpiMark 5-hmC and 5-mC Analysis Kit has the following features:
    • Complete conversion of 5-hmC to glucosylated 5-hmC in DNA. 
    • Discrimination between 5-mC and 5-hmC in CCGG sequences using enzymatic. 
    • Digestion and PCR amplification. 
    • Relative quantitation of 5-mC and 5-hmC. Easy-to-use protocol. 
    This kit contains enough material for 20 reactions. An overview of the detection procedure is summarized in Figure 1.

    Control DNA Sequence 
    5´-CAGTGAAGTTGGCAGACTGAGCCAGGTCCCACAGATGCAGTGACCGGAGT
    CATTGCCAAACTCTGCAGGAGAGCAAGGGCTGTCTATAGGTGGCAAGTCA-3´

    Control DNA substrates are synthetic 100 bp double stranded fragments containing a single MspI/HpaII site (CCGG). The three fragments are identical except for modification of the internal C in this site.

    FW Primer Sequence 
    5´- CA GTG AAG TTG GCA GAC TGA GC -3´

    REV Primer Sequence 
    5´- CTG ACT TGC CAC CTA TAG ACA GC -3´

    Kit Components

    The following reagents are supplied with this product:

    Store at (°C)Concentration
    Unmodified Control DNA0.1 ng/μl
    5-mC Control DNA0.1 ng/μl
    5-hmC Control DNA0.1 ng/μl
    MspI-20100,000 units/ml
    HpaII-2050,000 units/ml
    Control DNA Primer Mix10 μM each
    Uridine Diphosphate Glucose25X
    NEBuffer 4-2010X
    T4 Phage β-glucosyltransferase (T4-BGT)-2010,000 units/ml
    Proteinase K, Molecular Biology Grade-2020 mg/ml

    Properties and Usage

    Materials Required but not Supplied

    Heat block or water bath (suitable for temperatures of 37°C, 40°C and 95°C) PCR materials:
    • Locus-specific primers, flanking a CCGG site of interest
    • DNA polymerase for PCR
    • Nucleotides for PCR
    • PCR Thermal Cycler (for endpoint experiments, option IIIa)
    • Real-time PCR cycler (for quantitative experiments, option IIIb)
    0.2 ml strip tubes and caps for PCR
    1.5 ml reaction tubes
    Molecular biology grade water

    Storage Temperature

    -20°C

    Method Overview

    Method Overview

    Step I: DNA Glucosylation Reaction with T4 β-glucosyltransferase (T4-BGT) Genomic DNA of interest is treated with T4-BGT, adding a glucose moeity to 5-hydroxymethylcytosine. This reaction is sequence-independent - therefore all 5-hmC will be glucosylated, unmodified or 5-mC containing DNA will not be  affected.

    Step II: Restriction Endonuclease Digestion MspI and HpaII recognize the same sequence (CCGG) but are sensitive to different methylation status. HpaII cleaves only a completely unmodified site: any modification (5-mC, 5-hmC or 5-ghmC) at either cytosine blocks cleavage. MspI will recognize and cleave 5-mC and 5-hmC, but not 5-ghmC.

    Step III: Interrogation of the Locus by PCR as little as 20 ng of input DNA can be used. Amplification of the experimental (glucosylated and digested) and control (mock glucosylated and digested) target DNA with primers flanking a CCGG site of interest (100–200 bp) is performed. If the CpG site contains 5-hydroxymethylcytosine, a band is detected after glucosylation and digestion, but not in the non-glucosylated control reaction (see Figure 2). Real time PCR will give an approximation of how much hydroxymethylcytosine is in this particular site.

    Figure 1a: Experimental Overview
    The DNA of interest is treated with T4 β-Glucosyltransferase (T4-BGT) and UDP-Glucose (UDP-Glc). T4-BGT transfers glucose from UDP-Glc onto 5-hydroxymethylcytosine (generating glucosylated 5-hydroxymethylcytosine [5-ghmC]). MspI cuts DNA containing 5-hmC, but does not cut 5-ghmC containing sites; in contrast, HpaII is blocked by any of these modifications. Presence of 5-hmC and 5-mC can be determined by PCR analysis.
    Figure 1b: Experimental Overview
    The DNA of interest is digested following a control reaction with UDP-Glucose (UDP-Glc) and no T4 β-Glucosyltransferase (T4-BGT), leaving 5-hmC unmodified. MspI cleaves unmodified, 5-mC and 5-hmC DNA, while HpaII cleaves only unmodified DNA.
    Figure 2: Comparison of 5-hydroxymethylcytosine amounts at locus 12 in different mouse Balb/C tissue samples. (A) End-point PCR. (B) Real time PCR.
    DNA from four mouse tissues was analyzed. For comparative purposes, real time PCR data were normalized to uncut DNA. A standard curve was used to determine copy number. The samples could be normalized by dividing the copy number of samples No 1-6 by the copy number of the control that is undigested (No 5). Boxed gel lane shows variation in 5-hmC present.
    Figure 3: High sensitivity 5-hydroxymethylcytosine detection achieved by the EpiMark kit.
    100 bp unmodified, 5-mC, and 5-hmC control DNAs were mixed in different ratios (blue bars), and then measured with the EpiMark hydroxymethylated DNA detection kit (orange bars). Error bars represent the standard deviation of four independent experiments.

    References

    1. Tahiliani, M., Koh, K.P., Shen, Y., Pastor, W.A., Bandukwala, H., Brudno, Y., Agarwal, (2009). Science 324. 930-935, PubMedID: 19372391
    2. Huang, Y, Pastor, W.A., Shen, Y., Tahiliani, M., Liu, D.R., Rao, A. (2010). PloS One. PubMedID: 20126651
    3. Kriaucionis, S. and Heintz, N. (2009). Science 324. 929-930, Epub 2009 Apr 16.

    Supporting Documents

    Material Safety Datasheets

    The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

    Manuals

    The Product Manual includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name these document files: manual[Catalog Number].
    1. Does the T4-BGT show any site preference?
    2. How do I know if the glucosylation of 5-hmC in my DNA is complete?
    3. How much control DNA should I use in my qPCR?
    4. Do I need to do extra purification steps for a mammalian DNA prep in order to use it in a glucosylation reaction?
    1. Reaction Protocol for EpiMark® 5-hmC and 5-mC Analysis Kit (E3317)

    Application Notes

    Citations

    • Bhattacharyya, S., Yu, Y., Suzuki, M., Campbell, N., Mazdo, J., Vasanthakumar, A., et al. (2013) Genome-wide hydroxymethylation tested using the HELP-GT assay shows redistribution in cancer Nucleic Acids Research DOI: doi:10.1093/nar/gkt601