FAQ: How should my NEBNext Small RNA library be trimmed?

Use these sequences:

Single Ends Reads (Read 1): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Paired End Reads (Read 2): GATCGTCGGACTGTAGAACTCTGAAC