• My NEB
  • Print
  • PDF
  • FAQ: What is the sequence of the loxP sites in the pLox2+ control DNA to be used with Cre Recombinase?

    5' ATAACTTCGTATAATGTATGCTATACGAAGTTAT 3' (1)
    (1) Metzger, D. and Feil, R. (1999) Curr. Opin. Biotechnol. 10, 470-476.