• My NEB
  • Print
  • PDF
  • FAQ: What is the sequence of the L1 primer mix?

    There is both a forward and reverse primer in the mix. The primer sequences are: CCTGCTCTGCCGCTTCACGC and GATGACGCATCCTCACGATAATATCCGG for the forward and reverse primers, respectively. These primers are described in Wang, Y., et al., Nucleic Acids Res. (2004) 32(3):1197.