We use cookies to understand how you use our site and to improve the overall user experience. This includes personalizing content and advertising. To learn more and manage cookies, please refer to our Cookie Statement.
HomeFAQsWhat is the sequence of the L1 primer mix?
FAQ: What is the sequence of the L1 primer mix?
There is both a forward and reverse primer in the mix. The primer sequences are: CCTGCTCTGCCGCTTCACGC and GATGACGCATCCTCACGATAATATCCGG for the forward and reverse primers, respectively. These primers are described in Wang, Y., et al., Nucleic Acids Res. (2004) 32(3):1197.
Choose your country
North America
Europe
Asia-Pacific
Session Expired
You have been idle for more than 20 minutes, for your security you have been logged out. Please sign back in to continue your session.
Institution Changed
Your profile has been mapped to an Institution, please sign back for your profile updates to be completed.
Sign in to your NEB account
To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.