FAVORITE TOOLS Enzyme Finder Double Digest NEBcutter REBASE

PrimerN (30-mer) Discontinued as of 4/1/09. Contact info@neb.com for assistance. Download: MSDS PDF Description: This primer generates sequence data from target DNA adjacent to the Tn7R (NotI) end of the Transprimer element. It is complementary to the Transprimer sequence 31-61 nucleotides from the end of the Tn7R (NotI) end of the element. Sequence: 5´d(ACTTTATTGTCATAGTTTAGATCTATTTTG) 3' Phosphorylated: No Length: 30 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 159 μl Storage Conditions Storage Temperature: -20°C