 |
|
 |
 |
 |
 |  |  | | PrimerS (30-mer) |  |  | Discontinued as of 4/1/09. Contact info@neb.com for assistance. |  |
|  |

 Description: This primer generates sequence data from target DNA adjacent to the Tn7L (SpeI) end of the Transprimer element.
It is complementary to the Transprimer sequence 31-61 nucleotides from the end of the Tn7L (SpeI) end of the element.
Sequence: 5´d(ATAATCCTTAAAAACTCCATTTCCACCCCT) 3´ Phosphorylated:
No
Length: 30 -mer
Properties & Usage

 Supplied As: Lyophilized Triethylammonium Salt
Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 159 μl
Storage Conditions

 Storage Temperature: -20°C
| |
 |
|
 |