To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE

Home > Products > Nucleic Acids > Primers > IMPACT Primers > Mxe Intein Reverse II Primer (20-mer) Mxe Intein Reverse II Primer (20-mer) Catalog # Size Concentration Price Qty   S1285S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: Mxe Intein Reverse II Primer generates sequence data from the 3´ region of the target gene after it is cloned into the pTXB vectors or pTWINI (intein 2) which contains an engineered intein from the gyrA gene of Mycobacterium xenopi. After annealing, the 3´ end of the primer is 118 bases from the SapI site of pTXB or pTWIN1 vectors. Sequence: 5' d(GATTGCCATGCCGGTCAAGG) 3' Phosphorylated: No Orientation: Reverse Length: 20 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 262 μl Storage Conditions Storage Temperature: -20°C Notes General notes: 0.5 A260 unit  ~= 16 µg = 2.62 nanomoles