To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE pCMV-GLuc Control Plasmid pGLuc-Basic Forward Sequencing Primer (23-mer) pGLuc-Basic Vector pNEBR-X1GLuc Control Plasmid

Home > Products > Nucleic Acids > Primers > pGLuc Sequencing Primers > pGLuc-Reverse Sequencing Primer (24-mer) pGLuc-Reverse Sequencing Primer (24-mer) Catalog # Size Concentration Price Qty   S1283S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer is suitable for sequencing through the cloning region of Gaussia Luciferase containing plasmids, such as the pGLuc-Basic Vector. The primer will anneal between nucleotides 81-105 downstream of the multiple cloning site of the pGLuc-Basic Vector. Sequence: 5´ d(TCAGGGCAAACAGAACTTTGACTC) 3´ Orientation: Reverse Length: 24 -mer Compatible Plasmids: pGLuc Basic Vector (NEB #8082), pCMV-GLuc Control Plasmid (NEB #8081) and pNEBR-X1GLuc Control Plasmid (NEB #8080) Properties & Usage Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 214 μl Storage Conditions Storage Temperature: -20°C Notes General notes: 0.5 A260 unit = ~ 15.73 µg or 2.14 nmol primer. Companion Products pCMV-GLuc Control Plasmid pGLuc-Basic Forward Sequencing Primer (23-mer) pGLuc-Basic Vector pNEBR-X1GLuc Control Plasmid