To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE pGLuc-Basic Vector pGLuc-Reverse Sequencing Primer (24-mer)

Home > Products > Nucleic Acids > Primers > pGLuc Sequencing Primers > pGLuc-Basic Forward Sequencing Primer (23-mer) pGLuc-Basic Forward Sequencing Primer (23-mer) Catalog # Size Concentration Price Qty   S1282S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer is suitable for sequencing through the cloning region of pGLuc-Basic Vector. The primer anneals between nucleotides 4878-4901 upstream of the multiple cloning site of the pGLuc-Basic Vector. Sequence: 5´ d(GGGGTTCCGCGCACATTTCCCCG) 3´ Orientation: Forward Length: 23 -mer Compatible Plasmids: pGLuc Basic Vector (NEB #8082) Properties & Usage Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 246 μl Storage Conditions Storage Temperature: -20°C Notes General notes: 0.5 A260 unit = ~ 17.2 µg or 2.46 nmol primer. Companion Products pGLuc-Basic Vector pGLuc-Reverse Sequencing Primer (24-mer)