To access your account, log in or register.	shopping cart | log in

FAQs for Nucleic Acids Technical Reference for Nucleic Acids Enzyme Finder NEBcutter NEBuffer Chart Double Digest Finder Isoschizomers DNA Sequences and Maps REBASE

Home > Products > Nucleic Acids > Primers > IMPACT Primers > Ssp DnaB Intein Forward Primer (20-mer) Ssp DnaB Intein Forward Primer (20-mer) Catalog # Size Concentration Price Qty   S1269S 0.5 A260 units   $100.00 Prices are in US dollars and valid only for US orders. Download: MSDS PDF Description: This primer generates sequence data from the 5´ region of the target gene after it is cloned into the pTWIN1 and pTWIN2 vectors. This primer anneals to the Ssp DnaB mini-intein sequence 87 nt upstream from the C-terminal splice junction (or cleavage site). Sequence: 5´ d(ACTGGGACTCCATCGTTTCT) 3´ Phosphorylated: No Orientation: Forward Length: 20 -mer Properties & Usage Supplied As: Lyophilized Triethylammonium Salt Suggested Working Concentration: 10 μM Recommended Resuspension Volume: 250 μl Storage Conditions Storage Temperature: -20°C